EMAIL THIS PAGE TO A FRIEND

TRIM58

tripartite motif containing 58

Synonyms: BIA2
UniProtKB ID: Q8NG06, Q6B0H9
Gene ID:
Mouse(216781) tripartite motif-containing 58
Rat(303167) tripartite motif-containing 58
naked mole-rat(101703341) tripartite motif containing 58
domestic guinea pig(100730247) tripartite motif containing 58
cow(525584) tripartite motif containing 58
sheep(101109795) tripartite motif containing 58
Horse(100069625) tripartite motif containing 58
dog(482216) tripartite motif containing 58
domestic cat(101089166) tripartite motif containing 58
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_359262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_359262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_359262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015431 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035051 MISSION® esiRNA esiRNA human TRIM58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015431 Rosetta Predictions human pricing
XM_001075898 Rosetta Predictions rat pricing
XM_220473 Rosetta Predictions rat pricing
NM_001039047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347815 predicted 1371
2 SASI_Hs02_00347816 predicted 542
3 SASI_Hs01_00174479 predicted 1286
4 SASI_Hs01_00174481 predicted 1430
5 SASI_Hs01_00174482 predicted 1024
6 SASI_Hs01_00174484 predicted 1007
7 SASI_Hs01_00174485 predicted 1080
8 SASI_Hs01_00174486 predicted 1289
9 SASI_Hs01_00174488 predicted 908
10 SASI_Hs02_00347817 predicted 896
11 SASI_Hs01_00174480 predicted 1415
12 SASI_Hs01_00174483 predicted 1558
13 SASI_Hs01_00174487 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351429 predicted 687
2 SASI_Rn02_00351430 predicted 488
3 SASI_Rn02_00351431 predicted 552
4 SASI_Rn02_00351432 predicted 1017
5 SASI_Rn02_00351433 predicted 811
6 SASI_Rn02_00351434 predicted 464
7 SASI_Rn02_00351435 predicted 903
8 SASI_Rn02_00351436 predicted 527
9 SASI_Rn02_00351437 predicted 736
10 SASI_Rn02_00351438 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379311 predicted 688
2 SASI_Rn02_00379312 predicted 486
3 SASI_Rn02_00379313 predicted 556
4 SASI_Rn02_00379314 predicted 1021
5 SASI_Rn02_00379315 predicted 808
6 SASI_Rn02_00379316 predicted 461
7 SASI_Rn02_00379317 predicted 899
8 SASI_Rn02_00379318 predicted 519
9 SASI_Rn02_00379319 predicted 734
10 SASI_Rn02_00379320 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153990 predicted 532
2 SASI_Mm01_00153991 predicted 1334
3 SASI_Mm01_00153992 predicted 1281
4 SASI_Mm01_00153993 predicted 427
5 SASI_Mm01_00153994 predicted 1440
6 SASI_Mm01_00153995 predicted 1270
7 SASI_Mm01_00153996 predicted 1451
8 SASI_Mm01_00153997 predicted 1356
9 SASI_Mm01_00153998 predicted 1282
10 SASI_Mm01_00153999 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_359262
TRIM58 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 58
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-614s1c1
Sequence:CCGGGTTTGAGAAACACAGAGGGTTCTCGAGAACCCTCTGTGTTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1085s1c1
Sequence:CCGGGAGGCATTACTGGGAAGTCATCTCGAGATGACTTCCCAGTAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-494s1c1
Sequence:CCGGGTCTTTGGAACTTGTGAAGAACTCGAGTTCTTCACAAGTTCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1328s1c1
Sequence:CCGGCAATGTCACAAATGGGTCTTACTCGAGTAAGACCCATTTGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1307s1c1
Sequence:CCGGAGCTGGTGAAATCTCCTTCTACTCGAGTAGAAGGAGATTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_359262
TRIM58 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 58
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-614s1c1
Sequence:CCGGGTTTGAGAAACACAGAGGGTTCTCGAGAACCCTCTGTGTTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1085s1c1
Sequence:CCGGGAGGCATTACTGGGAAGTCATCTCGAGATGACTTCCCAGTAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-494s1c1
Sequence:CCGGGTCTTTGGAACTTGTGAAGAACTCGAGTTCTTCACAAGTTCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1328s1c1
Sequence:CCGGCAATGTCACAAATGGGTCTTACTCGAGTAAGACCCATTTGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1307s1c1
Sequence:CCGGAGCTGGTGAAATCTCCTTCTACTCGAGTAGAAGGAGATTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_359262
TRIM58 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 58
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-614s1c1
Sequence:CCGGGTTTGAGAAACACAGAGGGTTCTCGAGAACCCTCTGTGTTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1085s1c1
Sequence:CCGGGAGGCATTACTGGGAAGTCATCTCGAGATGACTTCCCAGTAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-494s1c1
Sequence:CCGGGTCTTTGGAACTTGTGAAGAACTCGAGTTCTTCACAAGTTCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1328s1c1
Sequence:CCGGCAATGTCACAAATGGGTCTTACTCGAGTAAGACCCATTTGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359262.1-1307s1c1
Sequence:CCGGAGCTGGTGAAATCTCCTTCTACTCGAGTAGAAGGAGATTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015431
TRIM58 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 58
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-1305s1c1
Sequence:CCGGCGGTGAAATTTCATTCTACAACTCGAGTTGTAGAATGAAATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-1203s1c1
Sequence:CCGGGCTGCTGAAAGGGAATGAGTACTCGAGTACTCATTCCCTTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-462s1c1
Sequence:CCGGCTACCAGGTAAAGCTCCAGATCTCGAGATCTGGAGCTTTACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-815s1c1
Sequence:CCGGGCAGAAGTAAGGCTGTCACAACTCGAGTTGTGACAGCCTTACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015431.3-1016s21c1
Sequence:CCGGCCAACAACCCTGAGCGATTTGCTCGAGCAAATCGCTCAGGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015431.3-587s21c1
Sequence:CCGGAGCGCTTCAGATTGGAGTTTGCTCGAGCAAACTCCAATCTGAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015431.3-1888s21c1
Sequence:CCGGCAGAATGGTCTGATACTATTCCTCGAGGAATAGTATCAGACCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015431.3-1714s21c1
Sequence:CCGGAGCAATCTCAACCTCTATTTCCTCGAGGAAATAGAGGTTGAGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015431
TRIM58 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 58
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-1305s1c1
Sequence:CCGGCGGTGAAATTTCATTCTACAACTCGAGTTGTAGAATGAAATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-1203s1c1
Sequence:CCGGGCTGCTGAAAGGGAATGAGTACTCGAGTACTCATTCCCTTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-462s1c1
Sequence:CCGGCTACCAGGTAAAGCTCCAGATCTCGAGATCTGGAGCTTTACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-815s1c1
Sequence:CCGGGCAGAAGTAAGGCTGTCACAACTCGAGTTGTGACAGCCTTACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015431.3-1016s21c1
Sequence:CCGGCCAACAACCCTGAGCGATTTGCTCGAGCAAATCGCTCAGGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015431.3-587s21c1
Sequence:CCGGAGCGCTTCAGATTGGAGTTTGCTCGAGCAAACTCCAATCTGAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015431.3-1888s21c1
Sequence:CCGGCAGAATGGTCTGATACTATTCCTCGAGGAATAGTATCAGACCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015431.3-1714s21c1
Sequence:CCGGAGCAATCTCAACCTCTATTTCCTCGAGGAAATAGAGGTTGAGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015431
TRIM58 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 58
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-1305s1c1
Sequence:CCGGCGGTGAAATTTCATTCTACAACTCGAGTTGTAGAATGAAATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-1203s1c1
Sequence:CCGGGCTGCTGAAAGGGAATGAGTACTCGAGTACTCATTCCCTTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-462s1c1
Sequence:CCGGCTACCAGGTAAAGCTCCAGATCTCGAGATCTGGAGCTTTACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015431.2-815s1c1
Sequence:CCGGGCAGAAGTAAGGCTGTCACAACTCGAGTTGTGACAGCCTTACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015431.3-1016s21c1
Sequence:CCGGCCAACAACCCTGAGCGATTTGCTCGAGCAAATCGCTCAGGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015431.3-587s21c1
Sequence:CCGGAGCGCTTCAGATTGGAGTTTGCTCGAGCAAACTCCAATCTGAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015431.3-1888s21c1
Sequence:CCGGCAGAATGGTCTGATACTATTCCTCGAGGAATAGTATCAGACCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015431.3-1714s21c1
Sequence:CCGGAGCAATCTCAACCTCTATTTCCTCGAGGAAATAGAGGTTGAGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks