EMAIL THIS PAGE TO A FRIEND

TRIM59

tripartite motif containing 59

Synonyms: MRF1 RNF104 TRIM57 TSBF1
UniProtKB ID: Q8IWR1, A8K5G9, D3DNL9
Gene ID:
Mouse(66949) tripartite motif-containing 59
Rat(365813) tripartite motif-containing 59
chicken(425013) tripartite motif containing 59
Horse(100049895) tripartite motif containing 59
domestic cat(101093456) tripartite motif containing 59
dog(488133) tripartite motif containing 59
cow(540154) tripartite motif containing 59
sheep(101105795) tripartite motif containing 59
domestic guinea pig(100732694) tripartite motif containing 59
naked mole-rat(101703051) tripartite motif containing 59
Domestic Rabbit(100349008) tripartite motif containing 59
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV43450 Anti-TRIM59 (AB1) antibody produced in rabbit affinity isolated antibody rabbit, bovine, mouse, human, guinea pig, canine, rat, horse
western blot pricing
AV43451 Anti-TRIM59 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, human, rat, guinea pig, rabbit, mouse, bovine, horse
immunohistochemistry, western blot pricing
HPA017750 Anti-TRIM59 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4501285 Anti-TRIM59 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033251 MISSION® esiRNA esiRNA targeting mouse Trim59 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173084 Rosetta Predictions human pricing
NM_001108945 Rosetta Predictions rat pricing
XM_345221 Rosetta Predictions rat pricing
NM_025863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166264 predicted 1316
2 SASI_Hs01_00166265 predicted 421
3 SASI_Hs02_00368084 predicted 1299
4 SASI_Hs01_00166267 predicted 330
5 SASI_Hs01_00166268 predicted 1071
6 SASI_Hs02_00368085 predicted 1007
7 SASI_Hs01_00166269 predicted 1014
8 SASI_Hs01_00166270 predicted 1422
9 SASI_Hs01_00166272 predicted 1079
10 SASI_Hs01_00166273 predicted 489
11 SASI_Hs01_00166266 predicted 1071
12 SASI_Hs01_00166271 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243634 predicted 293
2 SASI_Rn02_00243635 predicted 933
3 SASI_Rn02_00243636 predicted 1047
4 SASI_Rn02_00243637 predicted 1107
5 SASI_Rn02_00243638 predicted 1287
6 SASI_Rn02_00243639 predicted 407
7 SASI_Rn02_00243640 predicted 1275
8 SASI_Rn02_00243641 predicted 896
9 SASI_Rn02_00243642 predicted 356
10 SASI_Rn02_00243643 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159276 predicted 356
2 SASI_Rn01_00159277 predicted 411
3 SASI_Rn01_00159278 predicted 482
4 SASI_Rn01_00159279 predicted 406
5 SASI_Rn01_00159280 predicted 464
6 SASI_Rn01_00159281 predicted 355
7 SASI_Rn01_00159282 predicted 333
8 SASI_Rn01_00159283 predicted 498
9 SASI_Rn01_00159284 predicted 338
10 SASI_Rn01_00159285 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062142 predicted 1115
2 SASI_Mm01_00062143 predicted 1101
3 SASI_Mm01_00062144 predicted 550
4 SASI_Mm02_00329174 predicted 1142
5 SASI_Mm01_00062135 predicted 1328
6 SASI_Mm02_00329175 predicted 499
7 SASI_Mm01_00062136 predicted 438
8 SASI_Mm01_00062137 predicted 1073
9 SASI_Mm02_00329176 predicted 1260
10 SASI_Mm02_00329177 predicted 1089
11 SASI_Mm01_00062138 predicted 1007
12 SASI_Mm01_00062139 predicted 1273
13 SASI_Mm01_00062140 predicted 1403
14 SASI_Mm01_00062141 predicted 1409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173084
VALIDATED
TRIM59 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 59
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-492s21c1
Sequence:CCGGACATTACAGGCAACCATTAAACTCGAGTTTAATGGTTGCCTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-592s21c1
Sequence:CCGGGACCTTCAAAGTGCCTATTTGCTCGAGCAAATAGGCACTTTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-820s21c1
Sequence:CCGGGATGTTGGCAATCTAATTAATCTCGAGATTAATTAGATTGCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-1873s21c1
Sequence:CCGGAGTGATAAGGCATGGCTTAAACTCGAGTTTAAGCCATGCCTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-425s21c1
Sequence:CCGGTTGCACTAAGGGCTATTATTGCTCGAGCAATAATAGCCCTTAGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-351s21c1
Sequence:CCGGTCCACTCAAGTGCCCTAATTGCTCGAGCAATTAGGGCACTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-1236s21c1
Sequence:CCGGTTTCAACCAACACATCATAACCTCGAGGTTATGATGTGTTGGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-922s21c1
Sequence:CCGGCAAGAAGAGTCTCCACTTAAACTCGAGTTTAAGTGGAGACTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-401s1c1
Sequence:CCGGGCATTGAATCTTTACCTGTTACTCGAGTAACAGGTAAAGATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-811s1c1
Sequence:CCGGGCTCTCTGTGATGTTGGCAATCTCGAGATTGCCAACATCACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-360s1c1
Sequence:CCGGGTGCCCTAATTGCAGAAGTATCTCGAGATACTTCTGCAATTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173084.1-1004s1c1
Sequence:CCGGCTGAGGTTCAACCCGTTGAAACTCGAGTTTCAACGGGTTGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-1295s1c1
Sequence:CCGGCCTCTCTATCTGTTTACCAAACTCGAGTTTGGTAAACAGATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173084
VALIDATED
TRIM59 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 59
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-492s21c1
Sequence:CCGGACATTACAGGCAACCATTAAACTCGAGTTTAATGGTTGCCTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-592s21c1
Sequence:CCGGGACCTTCAAAGTGCCTATTTGCTCGAGCAAATAGGCACTTTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-820s21c1
Sequence:CCGGGATGTTGGCAATCTAATTAATCTCGAGATTAATTAGATTGCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-1873s21c1
Sequence:CCGGAGTGATAAGGCATGGCTTAAACTCGAGTTTAAGCCATGCCTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-425s21c1
Sequence:CCGGTTGCACTAAGGGCTATTATTGCTCGAGCAATAATAGCCCTTAGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-351s21c1
Sequence:CCGGTCCACTCAAGTGCCCTAATTGCTCGAGCAATTAGGGCACTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-1236s21c1
Sequence:CCGGTTTCAACCAACACATCATAACCTCGAGGTTATGATGTGTTGGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-922s21c1
Sequence:CCGGCAAGAAGAGTCTCCACTTAAACTCGAGTTTAAGTGGAGACTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-401s1c1
Sequence:CCGGGCATTGAATCTTTACCTGTTACTCGAGTAACAGGTAAAGATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-811s1c1
Sequence:CCGGGCTCTCTGTGATGTTGGCAATCTCGAGATTGCCAACATCACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-360s1c1
Sequence:CCGGGTGCCCTAATTGCAGAAGTATCTCGAGATACTTCTGCAATTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173084.1-1004s1c1
Sequence:CCGGCTGAGGTTCAACCCGTTGAAACTCGAGTTTCAACGGGTTGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-1295s1c1
Sequence:CCGGCCTCTCTATCTGTTTACCAAACTCGAGTTTGGTAAACAGATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173084
VALIDATED
TRIM59 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 59
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-492s21c1
Sequence:CCGGACATTACAGGCAACCATTAAACTCGAGTTTAATGGTTGCCTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-592s21c1
Sequence:CCGGGACCTTCAAAGTGCCTATTTGCTCGAGCAAATAGGCACTTTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-820s21c1
Sequence:CCGGGATGTTGGCAATCTAATTAATCTCGAGATTAATTAGATTGCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-1873s21c1
Sequence:CCGGAGTGATAAGGCATGGCTTAAACTCGAGTTTAAGCCATGCCTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-425s21c1
Sequence:CCGGTTGCACTAAGGGCTATTATTGCTCGAGCAATAATAGCCCTTAGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-351s21c1
Sequence:CCGGTCCACTCAAGTGCCCTAATTGCTCGAGCAATTAGGGCACTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173084.2-1236s21c1
Sequence:CCGGTTTCAACCAACACATCATAACCTCGAGGTTATGATGTGTTGGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173084.2-922s21c1
Sequence:CCGGCAAGAAGAGTCTCCACTTAAACTCGAGTTTAAGTGGAGACTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-401s1c1
Sequence:CCGGGCATTGAATCTTTACCTGTTACTCGAGTAACAGGTAAAGATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-811s1c1
Sequence:CCGGGCTCTCTGTGATGTTGGCAATCTCGAGATTGCCAACATCACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-360s1c1
Sequence:CCGGGTGCCCTAATTGCAGAAGTATCTCGAGATACTTCTGCAATTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173084.1-1004s1c1
Sequence:CCGGCTGAGGTTCAACCCGTTGAAACTCGAGTTTCAACGGGTTGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173084.1-1295s1c1
Sequence:CCGGCCTCTCTATCTGTTTACCAAACTCGAGTTTGGTAAACAGATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025863
VALIDATED
TRIM59 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 59
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-414s21c1
Sequence:CCGGGCATAGAATCCTTACCTGTAACTCGAGTTACAGGTAAGGATTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-505s21c1
Sequence:CCGGACACTACAGGCAACCATTAAACTCGAGTTTAATGGTTGCCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-1535s21c1
Sequence:CCGGGATGCAGAGAAATACGATAAACTCGAGTTTATCGTATTTCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-680s21c1
Sequence:CCGGACAGATATCACTCGCCTTATTCTCGAGAATAAGGCGAGTGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025863.3-436s21c1
Sequence:CCGGCTTTGCATTACGAGCAATTATCTCGAGATAATTGCTCGTAATGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-1242s1c1
Sequence:CCGGCCAGAGTTTATCTAAGAACTTCTCGAGAAGTTCTTAGATAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-863s1c1
Sequence:CCGGCTCCACTTAAATTTCTGGAAACTCGAGTTTCCAGAAATTTAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025863.2-157s1c1
Sequence:CCGGCCCATCTGTTACAGCATCTTTCTCGAGAAAGATGCTGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025863.2-332s1c1
Sequence:CCGGGCATAGAATCCTTACCTGTAACTCGAGTTACAGGTAAGGATTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-996s1c1
Sequence:CCGGCAGAATAGAAATTGGACGTATCTCGAGATACGTCCAATTTCTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025863
VALIDATED
TRIM59 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 59
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-414s21c1
Sequence:CCGGGCATAGAATCCTTACCTGTAACTCGAGTTACAGGTAAGGATTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-505s21c1
Sequence:CCGGACACTACAGGCAACCATTAAACTCGAGTTTAATGGTTGCCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-1535s21c1
Sequence:CCGGGATGCAGAGAAATACGATAAACTCGAGTTTATCGTATTTCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-680s21c1
Sequence:CCGGACAGATATCACTCGCCTTATTCTCGAGAATAAGGCGAGTGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025863.3-436s21c1
Sequence:CCGGCTTTGCATTACGAGCAATTATCTCGAGATAATTGCTCGTAATGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-1242s1c1
Sequence:CCGGCCAGAGTTTATCTAAGAACTTCTCGAGAAGTTCTTAGATAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-863s1c1
Sequence:CCGGCTCCACTTAAATTTCTGGAAACTCGAGTTTCCAGAAATTTAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025863.2-157s1c1
Sequence:CCGGCCCATCTGTTACAGCATCTTTCTCGAGAAAGATGCTGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025863.2-332s1c1
Sequence:CCGGGCATAGAATCCTTACCTGTAACTCGAGTTACAGGTAAGGATTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-996s1c1
Sequence:CCGGCAGAATAGAAATTGGACGTATCTCGAGATACGTCCAATTTCTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025863
VALIDATED
TRIM59 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 59
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-414s21c1
Sequence:CCGGGCATAGAATCCTTACCTGTAACTCGAGTTACAGGTAAGGATTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-505s21c1
Sequence:CCGGACACTACAGGCAACCATTAAACTCGAGTTTAATGGTTGCCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-1535s21c1
Sequence:CCGGGATGCAGAGAAATACGATAAACTCGAGTTTATCGTATTTCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025863.3-680s21c1
Sequence:CCGGACAGATATCACTCGCCTTATTCTCGAGAATAAGGCGAGTGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025863.3-436s21c1
Sequence:CCGGCTTTGCATTACGAGCAATTATCTCGAGATAATTGCTCGTAATGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-1242s1c1
Sequence:CCGGCCAGAGTTTATCTAAGAACTTCTCGAGAAGTTCTTAGATAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-863s1c1
Sequence:CCGGCTCCACTTAAATTTCTGGAAACTCGAGTTTCCAGAAATTTAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025863.2-157s1c1
Sequence:CCGGCCCATCTGTTACAGCATCTTTCTCGAGAAAGATGCTGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025863.2-332s1c1
Sequence:CCGGGCATAGAATCCTTACCTGTAACTCGAGTTACAGGTAAGGATTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025863.2-996s1c1
Sequence:CCGGCAGAATAGAAATTGGACGTATCTCGAGATACGTCCAATTTCTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks