EMAIL THIS PAGE TO A FRIEND

TRIM5

tripartite motif containing 5

Synonyms: RNF88 TRIM5alpha
Gene ID:
Human(85363) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein forms homo-oligomers via the coilel-coil region and localizes to cytoplasmic bodies. It appears to function as a E3 ubiquitin-ligase and ubiqutinates itself to regulate its subcellular localization. It may play a role in retroviral restriction. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2009]
Mouse(667823) tripartite motif-containing 5
Rat(308906) tripartite motif-containing 5
domestic cat(100302544) tripartite motif containing 5
Domestic Rabbit(100126072) tripartite motif containing 5
cow(505265) tripartite motif containing 5
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033034 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064231 MISSION® esiRNA esiRNA human TRIM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033034 Rosetta Predictions human pricing
NM_033092 Rosetta Predictions human pricing
NM_033093 Rosetta Predictions human pricing
NM_001014023 Rosetta Predictions rat pricing
XM_992714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143100 predicted 902
2 SASI_Hs01_00143101 predicted 928
3 SASI_Hs01_00143102 predicted 867
4 SASI_Hs01_00143103 predicted 254
5 SASI_Hs01_00143104 predicted 257
6 SASI_Hs01_00143105 predicted 884
7 SASI_Hs01_00143106 predicted 260
8 SASI_Hs01_00143107 predicted 873
9 SASI_Hs01_00143108 predicted 889
10 SASI_Hs01_00143109 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022552 predicted 902
2 SASI_Hs01_00022553 predicted 923
3 SASI_Hs01_00022554 predicted 873
4 SASI_Hs01_00022555 predicted 259
5 SASI_Hs01_00022556 predicted 256
6 SASI_Hs01_00022557 predicted 889
7 SASI_Hs01_00022558 predicted 253
8 SASI_Hs01_00022559 predicted 865
9 SASI_Hs01_00022560 predicted 890
10 SASI_Hs01_00022561 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075512 predicted 901
2 SASI_Hs01_00075513 predicted 928
3 SASI_Hs01_00075514 predicted 869
4 SASI_Hs01_00075515 predicted 255
5 SASI_Hs01_00075516 predicted 255
6 SASI_Hs01_00075517 predicted 889
7 SASI_Hs01_00075518 predicted 261
8 SASI_Hs01_00075519 predicted 869
9 SASI_Hs01_00075520 predicted 889
10 SASI_Hs01_00075521 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096010 predicted 1228
2 SASI_Rn01_00096011 predicted 606
3 SASI_Rn01_00096012 predicted 1208
4 SASI_Rn01_00096013 predicted 241
5 SASI_Rn01_00096014 predicted 669
6 SASI_Rn01_00096015 predicted 1428
7 SASI_Rn01_00096016 predicted 1313
8 SASI_Rn02_00201406 predicted 1409
9 SASI_Rn01_00096019 predicted 484
10 SASI_Rn02_00201407 predicted 798
11 SASI_Rn01_00096017 predicted 281
12 SASI_Rn01_00096018 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213987 predicted 706
2 SASI_Mm01_00213988 predicted 1127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033034
VALIDATED
TRIM5 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1481s21c1
Sequence:CCGGATCAACCTAAATACGGCTACTCTCGAGAGTAGCCGTATTTAGGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1083s21c1
Sequence:CCGGGACCTTGAAGAAGCCAGAAACCTCGAGGTTTCTGGCTTCTTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1670s21c1
Sequence:CCGGACCATGGATTTCTCATCTATACTCGAGTATAGATGAGAAATCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1775s21c1
Sequence:CCGGCAAGCTCTTGAACCTTCTTACCTCGAGGTAAGAAGGTTCAAGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1224s21c1
Sequence:CCGGCATTTCATGTGCTGTCATTTCCTCGAGGAAATGACAGCACATGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-434s21c1
Sequence:CCGGAGAAGTCCATGCTAGACAAAGCTCGAGCTTTGTCTAGCATGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1800s1c1
Sequence:CCGGCCTGAACTCATTTGCATCATTCTCGAGAATGATGCAAATGAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1265s1c1
Sequence:CCGGCCAGACATTTGTGAATTTCAACTCGAGTTGAAATTCACAAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-447s1c1
Sequence:CCGGCCTGAGAACATACGGCCTAATCTCGAGATTAGGCCGTATGTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1597s1c1
Sequence:CCGGGCACTGTCTCATTCTTCAATACTCGAGTATTGAAGAATGAGACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033034.1-1398s1c1
Sequence:CCGGCCTGATGCAATGTGTAATATTCTCGAGAATATTACACATTGCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033034
VALIDATED
TRIM5 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1481s21c1
Sequence:CCGGATCAACCTAAATACGGCTACTCTCGAGAGTAGCCGTATTTAGGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1083s21c1
Sequence:CCGGGACCTTGAAGAAGCCAGAAACCTCGAGGTTTCTGGCTTCTTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1670s21c1
Sequence:CCGGACCATGGATTTCTCATCTATACTCGAGTATAGATGAGAAATCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1775s21c1
Sequence:CCGGCAAGCTCTTGAACCTTCTTACCTCGAGGTAAGAAGGTTCAAGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1224s21c1
Sequence:CCGGCATTTCATGTGCTGTCATTTCCTCGAGGAAATGACAGCACATGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-434s21c1
Sequence:CCGGAGAAGTCCATGCTAGACAAAGCTCGAGCTTTGTCTAGCATGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1800s1c1
Sequence:CCGGCCTGAACTCATTTGCATCATTCTCGAGAATGATGCAAATGAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1265s1c1
Sequence:CCGGCCAGACATTTGTGAATTTCAACTCGAGTTGAAATTCACAAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-447s1c1
Sequence:CCGGCCTGAGAACATACGGCCTAATCTCGAGATTAGGCCGTATGTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1597s1c1
Sequence:CCGGGCACTGTCTCATTCTTCAATACTCGAGTATTGAAGAATGAGACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033034.1-1398s1c1
Sequence:CCGGCCTGATGCAATGTGTAATATTCTCGAGAATATTACACATTGCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033034
VALIDATED
TRIM5 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1481s21c1
Sequence:CCGGATCAACCTAAATACGGCTACTCTCGAGAGTAGCCGTATTTAGGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1083s21c1
Sequence:CCGGGACCTTGAAGAAGCCAGAAACCTCGAGGTTTCTGGCTTCTTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1670s21c1
Sequence:CCGGACCATGGATTTCTCATCTATACTCGAGTATAGATGAGAAATCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1775s21c1
Sequence:CCGGCAAGCTCTTGAACCTTCTTACCTCGAGGTAAGAAGGTTCAAGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-1224s21c1
Sequence:CCGGCATTTCATGTGCTGTCATTTCCTCGAGGAAATGACAGCACATGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033034.2-434s21c1
Sequence:CCGGAGAAGTCCATGCTAGACAAAGCTCGAGCTTTGTCTAGCATGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1800s1c1
Sequence:CCGGCCTGAACTCATTTGCATCATTCTCGAGAATGATGCAAATGAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1265s1c1
Sequence:CCGGCCAGACATTTGTGAATTTCAACTCGAGTTGAAATTCACAAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-447s1c1
Sequence:CCGGCCTGAGAACATACGGCCTAATCTCGAGATTAGGCCGTATGTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_033034.1-1597s1c1
Sequence:CCGGGCACTGTCTCATTCTTCAATACTCGAGTATTGAAGAATGAGACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033034.1-1398s1c1
Sequence:CCGGCCTGATGCAATGTGTAATATTCTCGAGAATATTACACATTGCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks