EMAIL THIS PAGE TO A FRIEND

TRIM6-TRIM34

TRIM6-TRIM34 readthrough

Synonyms: IFP1 RNF21 TRIM34
Gene ID:
Human(445372) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This gene represents a readthrough transcript from genes TRIM6 and TRIM34, and it was described as a splice variant of TRIM34. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. [provided by RefSeq, Nov 2009]
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003819 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003819 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157071 predicted 2404
2 SASI_Hs01_00157072 predicted 2211
3 SASI_Hs01_00157073 predicted 2466
4 SASI_Hs01_00157074 predicted 2477
5 SASI_Hs01_00157077 predicted 2048
6 SASI_Hs01_00157078 predicted 2322
7 SASI_Hs01_00157079 predicted 2423
8 SASI_Hs01_00157080 predicted 2127
9 SASI_Hs02_00304404 predicted 1935
10 SASI_Hs02_00304405 predicted 2109
11 SASI_Hs01_00157075 predicted 2416
12 SASI_Hs01_00157076 predicted 2226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003819
TRIM6-TRIM34 MISSION shRNA Bacterial Glycerol Stock
TRIM6-TRIM34 readthrough
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-339s1c1
Sequence:CCGGGTACTGGTGGACATACGAGAACTCGAGTTCTCGTATGTCCACCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-2268s1c1
Sequence:CCGGCAAGTGATATCTGTGCCAATTCTCGAGAATTGGCACAGATATCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-1495s1c1
Sequence:CCGGCATTTGAACATCTACAGGCTACTCGAGTAGCCTGTAGATGTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-882s1c1
Sequence:CCGGGAGTTTAATCAGCTGCGAAATCTCGAGATTTCGCAGCTGATTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003819.1-321s1c1
Sequence:CCGGGCTACAATGACTTCACCAGTACTCGAGTACTGGTGAAGTCATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003819.1-2855s1c1
Sequence:CCGGCCTTGTGGTTTCCCTTCTTTACTCGAGTAAAGAAGGGAAACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003819.1-1136s1c1
Sequence:CCGGCCCTACAAAGCTGAGAAGTATCTCGAGATACTTCTCAGCTTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003819
TRIM6-TRIM34 MISSION shRNA shRNA Plasmid DNA
TRIM6-TRIM34 readthrough
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-339s1c1
Sequence:CCGGGTACTGGTGGACATACGAGAACTCGAGTTCTCGTATGTCCACCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-2268s1c1
Sequence:CCGGCAAGTGATATCTGTGCCAATTCTCGAGAATTGGCACAGATATCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-1495s1c1
Sequence:CCGGCATTTGAACATCTACAGGCTACTCGAGTAGCCTGTAGATGTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-882s1c1
Sequence:CCGGGAGTTTAATCAGCTGCGAAATCTCGAGATTTCGCAGCTGATTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003819.1-321s1c1
Sequence:CCGGGCTACAATGACTTCACCAGTACTCGAGTACTGGTGAAGTCATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003819.1-2855s1c1
Sequence:CCGGCCTTGTGGTTTCCCTTCTTTACTCGAGTAAAGAAGGGAAACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003819.1-1136s1c1
Sequence:CCGGCCCTACAAAGCTGAGAAGTATCTCGAGATACTTCTCAGCTTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003819
TRIM6-TRIM34 MISSION shRNA Lentiviral Transduction Particles
TRIM6-TRIM34 readthrough
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-339s1c1
Sequence:CCGGGTACTGGTGGACATACGAGAACTCGAGTTCTCGTATGTCCACCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-2268s1c1
Sequence:CCGGCAAGTGATATCTGTGCCAATTCTCGAGAATTGGCACAGATATCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-1495s1c1
Sequence:CCGGCATTTGAACATCTACAGGCTACTCGAGTAGCCTGTAGATGTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003819.1-882s1c1
Sequence:CCGGGAGTTTAATCAGCTGCGAAATCTCGAGATTTCGCAGCTGATTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003819.1-321s1c1
Sequence:CCGGGCTACAATGACTTCACCAGTACTCGAGTACTGGTGAAGTCATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003819.1-2855s1c1
Sequence:CCGGCCTTGTGGTTTCCCTTCTTTACTCGAGTAAAGAAGGGAAACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003819.1-1136s1c1
Sequence:CCGGCCCTACAAAGCTGAGAAGTATCTCGAGATACTTCTCAGCTTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks