EMAIL THIS PAGE TO A FRIEND

TRIM60

tripartite motif containing 60

Synonyms: RNF129 RNF33
UniProtKB ID: Q495X7, Q8NA35
Gene ID:
Human(166655) Summary: The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. Pseudogenes of this gene are located on more than six chromosomes including chromosome 4. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
Mouse(234329) tripartite motif-containing 60
Domestic Rabbit(100351039) tripartite motif containing 60
naked mole-rat(101722308) tripartite motif containing 60
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152620 Rosetta Predictions human pricing
NM_153097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106606 predicted 1197
2 SASI_Hs02_00366479 predicted 1612
3 SASI_Hs01_00106608 predicted 905
4 SASI_Hs02_00366480 predicted 928
5 SASI_Hs01_00106609 predicted 506
6 SASI_Hs01_00106611 predicted 757
7 SASI_Hs01_00106612 predicted 1299
8 SASI_Hs01_00106613 predicted 620
9 SASI_Hs01_00106614 predicted 1321
10 SASI_Hs01_00106615 predicted 1255
11 SASI_Hs01_00106607 predicted 445
12 SASI_Hs01_00106610 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342946 predicted 666
2 SASI_Mm01_00067394 predicted 1386
3 SASI_Mm01_00067395 predicted 965
4 SASI_Mm01_00067396 predicted 1209
5 SASI_Mm01_00067399 predicted 1411
6 SASI_Mm01_00067400 predicted 928
7 SASI_Mm01_00067401 predicted 575
8 SASI_Mm01_00067402 predicted 1043
9 SASI_Mm01_00067403 predicted 1702
10 SASI_Mm02_00342947 predicted 1524
11 SASI_Mm01_00067397 predicted 944
12 SASI_Mm01_00067398 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152620
TRIM60 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 60
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-380s1c1
Sequence:CCGGGCTCCGTAATTTGACTGAAATCTCGAGATTTCAGTCAAATTACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-1201s1c1
Sequence:CCGGGATTTAGTTCTGGCCGACATTCTCGAGAATGTCGGCCAGAACTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-1337s1c1
Sequence:CCGGGCGATACATGAAGAGTGGTTACTCGAGTAACCACTCTTCATGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-618s1c1
Sequence:CCGGCCCTTGAGGAATAATATAGAACTCGAGTTCTATATTATTCCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-765s1c1
Sequence:CCGGGAGATGATTCTTAGGCAGATACTCGAGTATCTGCCTAAGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152620.2-1459s21c1
Sequence:CCGGATATGAATGATAGGTCTATTCCTCGAGGAATAGACCTATCATTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152620.2-1506s21c1
Sequence:CCGGGAAGCCGTTTGGCCTTATTTCCTCGAGGAAATAAGGCCAAACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152620.2-1618s21c1
Sequence:CCGCGTAGGTAACTTAGCCAGTAAACTCGAGTTTACTGGCTAAGTTACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152620
TRIM60 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 60
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-380s1c1
Sequence:CCGGGCTCCGTAATTTGACTGAAATCTCGAGATTTCAGTCAAATTACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-1201s1c1
Sequence:CCGGGATTTAGTTCTGGCCGACATTCTCGAGAATGTCGGCCAGAACTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-1337s1c1
Sequence:CCGGGCGATACATGAAGAGTGGTTACTCGAGTAACCACTCTTCATGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-618s1c1
Sequence:CCGGCCCTTGAGGAATAATATAGAACTCGAGTTCTATATTATTCCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-765s1c1
Sequence:CCGGGAGATGATTCTTAGGCAGATACTCGAGTATCTGCCTAAGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152620.2-1459s21c1
Sequence:CCGGATATGAATGATAGGTCTATTCCTCGAGGAATAGACCTATCATTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152620.2-1506s21c1
Sequence:CCGGGAAGCCGTTTGGCCTTATTTCCTCGAGGAAATAAGGCCAAACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152620.2-1618s21c1
Sequence:CCGCGTAGGTAACTTAGCCAGTAAACTCGAGTTTACTGGCTAAGTTACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152620
TRIM60 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 60
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-380s1c1
Sequence:CCGGGCTCCGTAATTTGACTGAAATCTCGAGATTTCAGTCAAATTACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-1201s1c1
Sequence:CCGGGATTTAGTTCTGGCCGACATTCTCGAGAATGTCGGCCAGAACTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-1337s1c1
Sequence:CCGGGCGATACATGAAGAGTGGTTACTCGAGTAACCACTCTTCATGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-618s1c1
Sequence:CCGGCCCTTGAGGAATAATATAGAACTCGAGTTCTATATTATTCCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152620.2-765s1c1
Sequence:CCGGGAGATGATTCTTAGGCAGATACTCGAGTATCTGCCTAAGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152620.2-1459s21c1
Sequence:CCGGATATGAATGATAGGTCTATTCCTCGAGGAATAGACCTATCATTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152620.2-1506s21c1
Sequence:CCGGGAAGCCGTTTGGCCTTATTTCCTCGAGGAAATAAGGCCAAACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152620.2-1618s21c1
Sequence:CCGCGTAGGTAACTTAGCCAGTAAACTCGAGTTTACTGGCTAAGTTACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153097
TRIM60 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 60
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1014s1c1
Sequence:CCGGGCGGAGTTTCTCAGAACTGAACTCGAGTTCAGTTCTGAGAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-414s1c1
Sequence:CCGGGCAGGACAAATGTATCTGTTACTCGAGTAACAGATACATTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1099s1c1
Sequence:CCGGGCCATACATGAAAGGTCAGATCTCGAGATCTGACCTTTCATGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-779s1c1
Sequence:CCGGCCATTAAGAAAGCCAGCTCTTCTCGAGAAGAGCTGGCTTTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1531s1c1
Sequence:CCGGCGGTATGCTGAGAATAGTTATCTCGAGATAACTATTCTCAGCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153097
TRIM60 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 60
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1014s1c1
Sequence:CCGGGCGGAGTTTCTCAGAACTGAACTCGAGTTCAGTTCTGAGAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-414s1c1
Sequence:CCGGGCAGGACAAATGTATCTGTTACTCGAGTAACAGATACATTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1099s1c1
Sequence:CCGGGCCATACATGAAAGGTCAGATCTCGAGATCTGACCTTTCATGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-779s1c1
Sequence:CCGGCCATTAAGAAAGCCAGCTCTTCTCGAGAAGAGCTGGCTTTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1531s1c1
Sequence:CCGGCGGTATGCTGAGAATAGTTATCTCGAGATAACTATTCTCAGCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153097
TRIM60 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 60
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1014s1c1
Sequence:CCGGGCGGAGTTTCTCAGAACTGAACTCGAGTTCAGTTCTGAGAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-414s1c1
Sequence:CCGGGCAGGACAAATGTATCTGTTACTCGAGTAACAGATACATTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1099s1c1
Sequence:CCGGGCCATACATGAAAGGTCAGATCTCGAGATCTGACCTTTCATGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-779s1c1
Sequence:CCGGCCATTAAGAAAGCCAGCTCTTCTCGAGAAGAGCTGGCTTTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153097.1-1531s1c1
Sequence:CCGGCGGTATGCTGAGAATAGTTATCTCGAGATAACTATTCTCAGCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks