EMAIL THIS PAGE TO A FRIEND

TRIM61

tripartite motif containing 61

Synonyms: RNF35
UniProtKB ID: Q5EBN2
Gene ID:
Mouse(260296) tripartite motif-containing 61
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012414 Rosetta Predictions human pricing
NM_153110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053158 predicted 815
2 SASI_Hs01_00053160 predicted 741
3 SASI_Hs01_00053161 predicted 705
4 SASI_Hs01_00053162 predicted 877
5 SASI_Hs01_00053163 predicted 783
6 SASI_Hs01_00053164 predicted 726
7 SASI_Hs01_00053165 predicted 893
8 SASI_Hs01_00053166 predicted 854
9 SASI_Hs01_00053167 predicted 736
10 SASI_Hs01_00053159 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107373 predicted 1059
2 SASI_Mm02_00342968 predicted 1094
3 SASI_Mm02_00342969 predicted 1274
4 SASI_Mm01_00107374 predicted 1680
5 SASI_Mm01_00107376 predicted 971
6 SASI_Mm01_00107377 predicted 999
7 SASI_Mm01_00107379 predicted 1345
8 SASI_Mm01_00107380 predicted 740
9 SASI_Mm01_00107381 predicted 1337
10 SASI_Mm01_00107382 predicted 1319
11 SASI_Mm01_00107375 predicted 1618
12 SASI_Mm01_00107378 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153110
TRIM61 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 61
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1795s1c1
Sequence:CCGGGCCTTACTTCTACACTGGATACTCGAGTATCCAGTGTAGAAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1292s1c1
Sequence:CCGGGACAGAATTATCAAGCGATTTCTCGAGAAATCGCTTGATAATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-519s1c1
Sequence:CCGGGCTGTTCTGTCTGTAAGGAATCTCGAGATTCCTTACAGACAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1826s1c1
Sequence:CCGGCCTCTGAAGATTTGCACAGTTCTCGAGAACTGTGCAAATCTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1354s1c1
Sequence:CCGGGCTTACAGTCTCAAAGGATAACTCGAGTTATCCTTTGAGACTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153110
TRIM61 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 61
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1795s1c1
Sequence:CCGGGCCTTACTTCTACACTGGATACTCGAGTATCCAGTGTAGAAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1292s1c1
Sequence:CCGGGACAGAATTATCAAGCGATTTCTCGAGAAATCGCTTGATAATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-519s1c1
Sequence:CCGGGCTGTTCTGTCTGTAAGGAATCTCGAGATTCCTTACAGACAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1826s1c1
Sequence:CCGGCCTCTGAAGATTTGCACAGTTCTCGAGAACTGTGCAAATCTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1354s1c1
Sequence:CCGGGCTTACAGTCTCAAAGGATAACTCGAGTTATCCTTTGAGACTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153110
TRIM61 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 61
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1795s1c1
Sequence:CCGGGCCTTACTTCTACACTGGATACTCGAGTATCCAGTGTAGAAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1292s1c1
Sequence:CCGGGACAGAATTATCAAGCGATTTCTCGAGAAATCGCTTGATAATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-519s1c1
Sequence:CCGGGCTGTTCTGTCTGTAAGGAATCTCGAGATTCCTTACAGACAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1826s1c1
Sequence:CCGGCCTCTGAAGATTTGCACAGTTCTCGAGAACTGTGCAAATCTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153110.2-1354s1c1
Sequence:CCGGGCTTACAGTCTCAAAGGATAACTCGAGTTATCCTTTGAGACTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012414
TRIM61 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 61
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-713s1c1
Sequence:CCGGCTTCTGTCTCTCCTGCATCATCTCGAGATGATGCAGGAGAGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-1108s1c1
Sequence:CCGGCCAGGAAATCACTGGAACTGACTCGAGTCAGTTCCAGTGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-739s1c1
Sequence:CCGGCCTGGAAGGATCTACATGATACTCGAGTATCATGTAGATCCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-893s1c1
Sequence:CCGGGCATGTGTGTAAGAAGCATAACTCGAGTTATGCTTCTTACACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-901s1c1
Sequence:CCGGGTAAGAAGCATAATCAGGTTTCTCGAGAAACCTGATTATGCTTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012414.1-1351s1c1
Sequence:CCGGCCATGTGTAGGGTATGTATATCTCGAGATATACATACCCTACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-1094s1c1
Sequence:CCGGCATAACTATGCAAACCAGGAACTCGAGTTCCTGGTTTGCATAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-821s1c1
Sequence:CCGGGCTGGGTAGTTTGACTGAAATCTCGAGATTTCAGTCAAACTACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-725s1c1
Sequence:CCGGCTGCATCATTATGTCCTGGAACTCGAGTTCCAGGACATAATGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-669s1c1
Sequence:CCGGCTGGACTACTTGAAAGACCCACTCGAGTGGGTCTTTCAAGTAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012414
TRIM61 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 61
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-713s1c1
Sequence:CCGGCTTCTGTCTCTCCTGCATCATCTCGAGATGATGCAGGAGAGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-1108s1c1
Sequence:CCGGCCAGGAAATCACTGGAACTGACTCGAGTCAGTTCCAGTGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-739s1c1
Sequence:CCGGCCTGGAAGGATCTACATGATACTCGAGTATCATGTAGATCCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-893s1c1
Sequence:CCGGGCATGTGTGTAAGAAGCATAACTCGAGTTATGCTTCTTACACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-901s1c1
Sequence:CCGGGTAAGAAGCATAATCAGGTTTCTCGAGAAACCTGATTATGCTTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012414.1-1351s1c1
Sequence:CCGGCCATGTGTAGGGTATGTATATCTCGAGATATACATACCCTACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-1094s1c1
Sequence:CCGGCATAACTATGCAAACCAGGAACTCGAGTTCCTGGTTTGCATAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-821s1c1
Sequence:CCGGGCTGGGTAGTTTGACTGAAATCTCGAGATTTCAGTCAAACTACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-725s1c1
Sequence:CCGGCTGCATCATTATGTCCTGGAACTCGAGTTCCAGGACATAATGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-669s1c1
Sequence:CCGGCTGGACTACTTGAAAGACCCACTCGAGTGGGTCTTTCAAGTAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012414
TRIM61 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 61
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-713s1c1
Sequence:CCGGCTTCTGTCTCTCCTGCATCATCTCGAGATGATGCAGGAGAGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-1108s1c1
Sequence:CCGGCCAGGAAATCACTGGAACTGACTCGAGTCAGTTCCAGTGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-739s1c1
Sequence:CCGGCCTGGAAGGATCTACATGATACTCGAGTATCATGTAGATCCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-893s1c1
Sequence:CCGGGCATGTGTGTAAGAAGCATAACTCGAGTTATGCTTCTTACACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-901s1c1
Sequence:CCGGGTAAGAAGCATAATCAGGTTTCTCGAGAAACCTGATTATGCTTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012414.1-1351s1c1
Sequence:CCGGCCATGTGTAGGGTATGTATATCTCGAGATATACATACCCTACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-1094s1c1
Sequence:CCGGCATAACTATGCAAACCAGGAACTCGAGTTCCTGGTTTGCATAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-821s1c1
Sequence:CCGGGCTGGGTAGTTTGACTGAAATCTCGAGATTTCAGTCAAACTACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-725s1c1
Sequence:CCGGCTGCATCATTATGTCCTGGAACTCGAGTTCCAGGACATAATGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012414.1-669s1c1
Sequence:CCGGCTGGACTACTTGAAAGACCCACTCGAGTGGGTCTTTCAAGTAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks