EMAIL THIS PAGE TO A FRIEND

TRIM62

tripartite motif containing 62

Synonyms: DEAR1
UniProtKB ID: Q9BVG3, B3KVH5, D3DPR1, Q9NVG0
Gene ID:
Mouse(67525) tripartite motif-containing 62
Rat(313045) tripartite motif-containing 62
cow(516886) tripartite motif containing 62
sheep(101104214) tripartite motif containing 62
naked mole-rat(101698866) tripartite motif containing 62
domestic guinea pig(100726017) tripartite motif containing 62
Zebrafish(791192) tripartite motif containing 62
domestic cat(101083783) tripartite motif containing 62
dog(487300) tripartite motif containing 62
chicken(429807) tripartite motif containing 62
186 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018207 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018207 Rosetta Predictions human pricing
XM_001060201 Rosetta Predictions rat pricing
XM_232757 Rosetta Predictions rat pricing
NM_178110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225705 predicted 1447
2 SASI_Hs01_00225706 predicted 1379
3 SASI_Hs01_00225707 predicted 2086
4 SASI_Hs01_00225708 predicted 1153
5 SASI_Hs01_00225709 predicted 431
6 SASI_Hs01_00225710 predicted 1381
7 SASI_Hs01_00225711 predicted 2092
8 SASI_Hs02_00351508 predicted 1030
9 SASI_Hs01_00225712 predicted 2141
10 SASI_Hs01_00225713 predicted 1204
11 SASI_Hs01_00225714 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295710 predicted 1141
2 SASI_Rn02_00295711 predicted 579
3 SASI_Rn02_00295712 predicted 1305
4 SASI_Rn02_00295713 predicted 1683
5 SASI_Rn02_00295714 predicted 1599
6 SASI_Rn02_00295715 predicted 1470
7 SASI_Rn02_00295716 predicted 584
8 SASI_Rn02_00295717 predicted 1502
9 SASI_Rn02_00295718 predicted 1359
10 SASI_Rn02_00295719 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387215 predicted 1528
2 SASI_Rn02_00387216 predicted 967
3 SASI_Rn02_00387217 predicted 1694
4 SASI_Rn02_00387218 predicted 2074
5 SASI_Rn02_00387219 predicted 1986
6 SASI_Rn02_00387220 predicted 1855
7 SASI_Rn02_00387221 predicted 980
8 SASI_Rn02_00387222 predicted 1890
9 SASI_Rn02_00387223 predicted 1748
10 SASI_Rn02_00387224 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167186 predicted 647
2 SASI_Mm01_00167187 predicted 215
3 SASI_Mm01_00167188 predicted 1242
4 SASI_Mm01_00167189 predicted 1139
5 SASI_Mm01_00167190 predicted 1752
6 SASI_Mm01_00167191 predicted 231
7 SASI_Mm01_00167192 predicted 423
8 SASI_Mm01_00167193 predicted 1899
9 SASI_Mm01_00167194 predicted 1114
10 SASI_Mm02_00348573 predicted 1924
11 SASI_Mm01_00167195 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178110
TRIM62 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 62
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178110.2-2309s1c1
Sequence:CCGGGCACAAACAATAGCCGCCTTACTCGAGTAAGGCGGCTATTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-1182s1c1
Sequence:CCGGCGGCTTCTACTGCATCGTTATCTCGAGATAACGATGCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-525s1c1
Sequence:CCGGAGAGACCAAGTCCTCTACCAACTCGAGTTGGTAGAGGACTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-643s1c1
Sequence:CCGGGCCCGCACACTGACGGACATTCTCGAGAATGTCCGTCAGTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-1309s1c1
Sequence:CCGGCTCATCTTCTACAACGCCGATCTCGAGATCGGCGTTGTAGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-1013s21c1
Sequence:CCGGAGGACTCACCAAAGCGCTTTGCTCGAGCAAAGCGCTTTGGTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-816s21c1
Sequence:CCGGCAACCTAACGTACGAAGACTTCTCGAGAAGTCTTCGTACGTTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-591s21c1
Sequence:CCGGGCTACTTCGAGAGCGACAGAACTCGAGTTCTGTCGCTCTCGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-863s21c1
Sequence:CCGGTGCAGTACACCATCTGGAAATCTCGAGATTTCCAGATGGTGTACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178110
TRIM62 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 62
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178110.2-2309s1c1
Sequence:CCGGGCACAAACAATAGCCGCCTTACTCGAGTAAGGCGGCTATTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-1182s1c1
Sequence:CCGGCGGCTTCTACTGCATCGTTATCTCGAGATAACGATGCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-525s1c1
Sequence:CCGGAGAGACCAAGTCCTCTACCAACTCGAGTTGGTAGAGGACTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-643s1c1
Sequence:CCGGGCCCGCACACTGACGGACATTCTCGAGAATGTCCGTCAGTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-1309s1c1
Sequence:CCGGCTCATCTTCTACAACGCCGATCTCGAGATCGGCGTTGTAGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-1013s21c1
Sequence:CCGGAGGACTCACCAAAGCGCTTTGCTCGAGCAAAGCGCTTTGGTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-816s21c1
Sequence:CCGGCAACCTAACGTACGAAGACTTCTCGAGAAGTCTTCGTACGTTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-591s21c1
Sequence:CCGGGCTACTTCGAGAGCGACAGAACTCGAGTTCTGTCGCTCTCGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-863s21c1
Sequence:CCGGTGCAGTACACCATCTGGAAATCTCGAGATTTCCAGATGGTGTACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178110
TRIM62 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 62
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178110.2-2309s1c1
Sequence:CCGGGCACAAACAATAGCCGCCTTACTCGAGTAAGGCGGCTATTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-1182s1c1
Sequence:CCGGCGGCTTCTACTGCATCGTTATCTCGAGATAACGATGCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-525s1c1
Sequence:CCGGAGAGACCAAGTCCTCTACCAACTCGAGTTGGTAGAGGACTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-643s1c1
Sequence:CCGGGCCCGCACACTGACGGACATTCTCGAGAATGTCCGTCAGTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178110.2-1309s1c1
Sequence:CCGGCTCATCTTCTACAACGCCGATCTCGAGATCGGCGTTGTAGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-1013s21c1
Sequence:CCGGAGGACTCACCAAAGCGCTTTGCTCGAGCAAAGCGCTTTGGTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-816s21c1
Sequence:CCGGCAACCTAACGTACGAAGACTTCTCGAGAAGTCTTCGTACGTTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-591s21c1
Sequence:CCGGGCTACTTCGAGAGCGACAGAACTCGAGTTCTGTCGCTCTCGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178110.2-863s21c1
Sequence:CCGGTGCAGTACACCATCTGGAAATCTCGAGATTTCCAGATGGTGTACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018207
TRIM62 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 62
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1386s1c1
Sequence:CCGGCGGCTTCTACTGCATCGTGATCTCGAGATCACGATGCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1179s1c1
Sequence:CCGGCATTGTGGCTTACGGCAACTTCTCGAGAAGTTGCCGTAAGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1513s1c1
Sequence:CCGGCTCATCTTCTACAATGCTGATCTCGAGATCAGCATTGTAGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1859s21c1
Sequence:CCGGTAACGTCCGGGACAAGCTTGACTCGAGTCAAGCTTGTCCCGGACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1059s21c1
Sequence:CCGGGACCAACTTCAGGCCCTTCAACTCGAGTTGAAGGGCCTGAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2219s21c1
Sequence:CCGGTTGCATTCCCTACTTCCTAAACTCGAGTTTAGGAAGTAGGGAATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1136s21c1
Sequence:CCGGGACCAAGTCTTCCACCAAGAGCTCGAGCTCTTGGTGGAAGACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2432s21c1
Sequence:CCGGAGTAGTTGGCAGCCCGAAAGACTCGAGTCTTTCGGGCTGCCAACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1479s21c1
Sequence:CCGGACCATCTGGAAGTCCCTGTTCCTCGAGGAACAGGGACTTCCAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-672s21c1
Sequence:CCGGTCCATCTGCCTGAGCATCTACCTCGAGGTAGATGCTCAGGCAGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-709s21c1
Sequence:CCGGTGGGCTGCGAGCATTACTTCTCTCGAGAGAAGTAATGCTCGCAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2501s21c1
Sequence:CCGGAGCTAGTGATGGGCCATTTACCTCGAGGTAAATGGCCCATCACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-925s21c1
Sequence:CCGGACGACAAGGTCAAGCTCTTCTCTCGAGAGAAGAGCTTGACCTTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018207
TRIM62 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 62
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1386s1c1
Sequence:CCGGCGGCTTCTACTGCATCGTGATCTCGAGATCACGATGCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1179s1c1
Sequence:CCGGCATTGTGGCTTACGGCAACTTCTCGAGAAGTTGCCGTAAGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1513s1c1
Sequence:CCGGCTCATCTTCTACAATGCTGATCTCGAGATCAGCATTGTAGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1859s21c1
Sequence:CCGGTAACGTCCGGGACAAGCTTGACTCGAGTCAAGCTTGTCCCGGACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1059s21c1
Sequence:CCGGGACCAACTTCAGGCCCTTCAACTCGAGTTGAAGGGCCTGAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2219s21c1
Sequence:CCGGTTGCATTCCCTACTTCCTAAACTCGAGTTTAGGAAGTAGGGAATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1136s21c1
Sequence:CCGGGACCAAGTCTTCCACCAAGAGCTCGAGCTCTTGGTGGAAGACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2432s21c1
Sequence:CCGGAGTAGTTGGCAGCCCGAAAGACTCGAGTCTTTCGGGCTGCCAACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1479s21c1
Sequence:CCGGACCATCTGGAAGTCCCTGTTCCTCGAGGAACAGGGACTTCCAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-672s21c1
Sequence:CCGGTCCATCTGCCTGAGCATCTACCTCGAGGTAGATGCTCAGGCAGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-709s21c1
Sequence:CCGGTGGGCTGCGAGCATTACTTCTCTCGAGAGAAGTAATGCTCGCAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2501s21c1
Sequence:CCGGAGCTAGTGATGGGCCATTTACCTCGAGGTAAATGGCCCATCACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-925s21c1
Sequence:CCGGACGACAAGGTCAAGCTCTTCTCTCGAGAGAAGAGCTTGACCTTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018207
TRIM62 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 62
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1386s1c1
Sequence:CCGGCGGCTTCTACTGCATCGTGATCTCGAGATCACGATGCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1179s1c1
Sequence:CCGGCATTGTGGCTTACGGCAACTTCTCGAGAAGTTGCCGTAAGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018207.1-1513s1c1
Sequence:CCGGCTCATCTTCTACAATGCTGATCTCGAGATCAGCATTGTAGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1859s21c1
Sequence:CCGGTAACGTCCGGGACAAGCTTGACTCGAGTCAAGCTTGTCCCGGACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1059s21c1
Sequence:CCGGGACCAACTTCAGGCCCTTCAACTCGAGTTGAAGGGCCTGAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2219s21c1
Sequence:CCGGTTGCATTCCCTACTTCCTAAACTCGAGTTTAGGAAGTAGGGAATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1136s21c1
Sequence:CCGGGACCAAGTCTTCCACCAAGAGCTCGAGCTCTTGGTGGAAGACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2432s21c1
Sequence:CCGGAGTAGTTGGCAGCCCGAAAGACTCGAGTCTTTCGGGCTGCCAACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-1479s21c1
Sequence:CCGGACCATCTGGAAGTCCCTGTTCCTCGAGGAACAGGGACTTCCAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-672s21c1
Sequence:CCGGTCCATCTGCCTGAGCATCTACCTCGAGGTAGATGCTCAGGCAGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-709s21c1
Sequence:CCGGTGGGCTGCGAGCATTACTTCTCTCGAGAGAAGTAATGCTCGCAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018207.2-2501s21c1
Sequence:CCGGAGCTAGTGATGGGCCATTTACCTCGAGGTAAATGGCCCATCACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018207.2-925s21c1
Sequence:CCGGACGACAAGGTCAAGCTCTTCTCTCGAGAGAAGAGCTTGACCTTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks