EMAIL THIS PAGE TO A FRIEND

TRIM63

tripartite motif containing 63, E3 ubiquitin protein ligase

Synonyms: IRF MURF1 MURF2 RNF28 SMRZ
UniProtKB ID: Q969Q1, Q5T2I1, Q96BD3, Q96KD9, Q9BYV4
Gene ID:
Human(84676) Summary: This gene encodes a member of the RING zinc finger protein family found in striated muscle and iris. The product of this gene is an E3 ubiquitin ligase that localizes to the Z-line and M-line lattices of myofibrils. This protein plays an important role in the atrophy of skeletal and cardiac muscle and is required for the degradation of myosin heavy chain proteins, myosin light chain, myosin binding protein, and for muscle-type creatine kinase. [provided by RefSeq, Feb 2012]
Mouse(433766) tripartite motif-containing 63
Rat(140939) tripartite motif containing 63, E3 ubiquitin protein ligase
Zebrafish(415223) tripartite motif containing 63
domestic cat(101083951) tripartite motif containing 63, E3 ubiquitin protein ligase
Horse(100071234) tripartite motif containing 63, E3 ubiquitin protein ligase
dog(487362) tripartite motif containing 63, E3 ubiquitin protein ligase
chicken(426754) tripartite motif containing 63, E3 ubiquitin protein ligase
domestic guinea pig(100716828) tripartite motif containing 63, E3 ubiquitin protein ligase
naked mole-rat(101705659) tripartite motif containing 63, E3 ubiquitin protein ligase
cow(528912) tripartite motif containing 63
sheep(100144767) tripartite motif containing 63, E3 ubiquitin protein ligase
sheep(101113132) tripartite motif containing 63, E3 ubiquitin protein ligase
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032588 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032588 Rosetta Predictions human pricing
NM_080903 Rosetta Predictions rat pricing
NM_001039048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127539 predicted 526
2 SASI_Hs01_00127540 predicted 635
3 SASI_Hs01_00127541 predicted 727
4 SASI_Hs01_00127542 predicted 1387
5 SASI_Hs01_00127543 predicted 800
6 SASI_Hs01_00127544 predicted 1407
7 SASI_Hs01_00127545 predicted 758
8 SASI_Hs02_00360119 predicted 274
9 SASI_Hs01_00127547 predicted 490
10 SASI_Hs02_00360120 predicted 290
11 SASI_Hs01_00127538 predicted 618
12 SASI_Hs01_00127546 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071328 predicted 505
2 SASI_Rn01_00071329 predicted 830
3 SASI_Rn01_00071330 predicted 1321
4 SASI_Rn01_00071331 predicted 1485
5 SASI_Rn01_00071332 predicted 1421
6 SASI_Rn01_00071333 predicted 218
7 SASI_Rn01_00071334 predicted 714
8 SASI_Rn01_00071335 predicted 507
9 SASI_Rn01_00071336 predicted 1563
10 SASI_Rn01_00071337 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197574 predicted 494
2 SASI_Mm02_00289728 predicted 1507
3 SASI_Mm02_00289729 predicted 1502
4 SASI_Mm01_00197575 predicted 518
5 SASI_Mm02_00289730 predicted 234
6 SASI_Mm02_00289731 predicted 1344
7 SASI_Mm01_00197576 predicted 725
8 SASI_Mm01_00197580 predicted 826
9 SASI_Mm02_00289732 predicted 299
10 SASI_Mm01_00197577 predicted 460
11 SASI_Mm01_00197578 predicted 834
12 SASI_Mm01_00197579 predicted 507
13 SASI_Mm01_00197581 predicted 626
14 SASI_Mm01_00197582 predicted 416
15 SASI_Mm01_00197583 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032588
TRIM63 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 63, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032588.2-681s21c1
Sequence:CCGGACCGTGTGCAGACCATCATCACTCGAGTGATGATGGTCTGCACACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032588.2-561s21c1
Sequence:CCGGGCTCCATGTGCAAGGTGTTTGCTCGAGCAAACACCTTGCACATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032588.2-1590s21c1
Sequence:CCGGGGAAGGAAGCCAGGTTGATACCTCGAGGTATCAACCTGGCTTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032588.2-1542s1c1
Sequence:CCGGGTATAATAATGCCTGGTCATTCTCGAGAATGACCAGGCATTATTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-284s1c1
Sequence:CCGGGACATCTTCCAGGCTGCAAATCTCGAGATTTGCAGCCTGGAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-1045s1c1
Sequence:CCGGGAACATGGACTTCTTTACTTTCTCGAGAAAGTAAAGAAGTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-767s1c1
Sequence:CCGGCAGAAGTTTGACACGTTGTATCTCGAGATACAACGTGTCAAACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-1154s1c1
Sequence:CCGGGAAGAGGAAGAGTCCACAGAACTCGAGTTCTGTGGACTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032588
TRIM63 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 63, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032588.2-681s21c1
Sequence:CCGGACCGTGTGCAGACCATCATCACTCGAGTGATGATGGTCTGCACACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032588.2-561s21c1
Sequence:CCGGGCTCCATGTGCAAGGTGTTTGCTCGAGCAAACACCTTGCACATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032588.2-1590s21c1
Sequence:CCGGGGAAGGAAGCCAGGTTGATACCTCGAGGTATCAACCTGGCTTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032588.2-1542s1c1
Sequence:CCGGGTATAATAATGCCTGGTCATTCTCGAGAATGACCAGGCATTATTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-284s1c1
Sequence:CCGGGACATCTTCCAGGCTGCAAATCTCGAGATTTGCAGCCTGGAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-1045s1c1
Sequence:CCGGGAACATGGACTTCTTTACTTTCTCGAGAAAGTAAAGAAGTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-767s1c1
Sequence:CCGGCAGAAGTTTGACACGTTGTATCTCGAGATACAACGTGTCAAACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-1154s1c1
Sequence:CCGGGAAGAGGAAGAGTCCACAGAACTCGAGTTCTGTGGACTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032588
TRIM63 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 63, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032588.2-681s21c1
Sequence:CCGGACCGTGTGCAGACCATCATCACTCGAGTGATGATGGTCTGCACACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032588.2-561s21c1
Sequence:CCGGGCTCCATGTGCAAGGTGTTTGCTCGAGCAAACACCTTGCACATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032588.2-1590s21c1
Sequence:CCGGGGAAGGAAGCCAGGTTGATACCTCGAGGTATCAACCTGGCTTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032588.2-1542s1c1
Sequence:CCGGGTATAATAATGCCTGGTCATTCTCGAGAATGACCAGGCATTATTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-284s1c1
Sequence:CCGGGACATCTTCCAGGCTGCAAATCTCGAGATTTGCAGCCTGGAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-1045s1c1
Sequence:CCGGGAACATGGACTTCTTTACTTTCTCGAGAAAGTAAAGAAGTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-767s1c1
Sequence:CCGGCAGAAGTTTGACACGTTGTATCTCGAGATACAACGTGTCAAACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032588.2-1154s1c1
Sequence:CCGGGAAGAGGAAGAGTCCACAGAACTCGAGTTCTGTGGACTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039048
TRIM63 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 63, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1067s21c1
Sequence:CCGGCATTGACTTTGGGACAGATGACTCGAGTCATCTGTCCCAAAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1096s21c1
Sequence:CCGGAGGAGGAGGAGTTTACAGAAGCTCGAGCTTCTGTAAACTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039048.2-1387s21c1
Sequence:CCGGTTTCTACGTTGGTGCGAAATGCTCGAGCATTTCGCACCAACGTAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1139s21c1
Sequence:CCGGCGTGACCACAGAGGGTAAAGACTCGAGTCTTTACCCTCTGTGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1171s21c1
Sequence:CCGGGAAGAAGGAGATGAGTGAGACCTCGAGGTCTCACTCATCTCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039048
TRIM63 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 63, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1067s21c1
Sequence:CCGGCATTGACTTTGGGACAGATGACTCGAGTCATCTGTCCCAAAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1096s21c1
Sequence:CCGGAGGAGGAGGAGTTTACAGAAGCTCGAGCTTCTGTAAACTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039048.2-1387s21c1
Sequence:CCGGTTTCTACGTTGGTGCGAAATGCTCGAGCATTTCGCACCAACGTAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1139s21c1
Sequence:CCGGCGTGACCACAGAGGGTAAAGACTCGAGTCTTTACCCTCTGTGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1171s21c1
Sequence:CCGGGAAGAAGGAGATGAGTGAGACCTCGAGGTCTCACTCATCTCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039048
TRIM63 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 63, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1067s21c1
Sequence:CCGGCATTGACTTTGGGACAGATGACTCGAGTCATCTGTCCCAAAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1096s21c1
Sequence:CCGGAGGAGGAGGAGTTTACAGAAGCTCGAGCTTCTGTAAACTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039048.2-1387s21c1
Sequence:CCGGTTTCTACGTTGGTGCGAAATGCTCGAGCATTTCGCACCAACGTAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1139s21c1
Sequence:CCGGCGTGACCACAGAGGGTAAAGACTCGAGTCTTTACCCTCTGTGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039048.2-1171s21c1
Sequence:CCGGGAAGAAGGAGATGAGTGAGACCTCGAGGTCTCACTCATCTCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks