EMAIL THIS PAGE TO A FRIEND

TRIM64

tripartite motif containing 64

Synonyms: C11orf28 TRIM64A
UniProtKB ID: A6NGJ6
Gene ID:
cow(521567) tripartite motif containing 64
domestic cat(101091395) tripartite motif containing 64
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_061890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061890 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129151 MISSION® esiRNA esiRNA human TRIM64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_061890 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_061890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478723 predicted 475
2 SASI_Hs01_00295035 predicted 404
3 SASI_Hs01_00295036 predicted 399
4 SASI_Hs02_00478724 predicted 458
5 SASI_Hs01_00295039 predicted 255
6 SASI_Hs02_00478725 predicted 392
7 SASI_Hs02_00478726 predicted 392
8 SASI_Hs02_00478727 predicted 411
9 SASI_Hs01_00295041 predicted 509
10 SASI_Hs01_00295042 predicted 435
11 SASI_Hs01_00295037 predicted 683
12 SASI_Hs01_00295038 predicted 224
13 SASI_Hs01_00295040 predicted 214
14 SASI_Hs01_00295043 predicted 394
15 SASI_Hs01_00295044 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061890
TRIM64 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 64
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-1087s21c1
Sequence:CCGGGCAGATGCCAATTTCGTTATTCTCGAGAATAACGAAATTGGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_061890.12-1353s21c1
Sequence:CCGGAGTTGGTTTCACGATGATTTACTCGAGTAAATCATCGTGAAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-453s21c1
Sequence:CCGGAGAGACAAGAAACAATCTAAACTCGAGTTTAGATTGTTTCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-484s21c1
Sequence:CCGGAGAACATTTCATTCGTTAAAGCTCGAGCTTTAACGAATGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-1139s21c1
Sequence:CCGGCAAAGAGGAGCAATCACTATACTCGAGTATAGTGATTGCTCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061890
TRIM64 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 64
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-1087s21c1
Sequence:CCGGGCAGATGCCAATTTCGTTATTCTCGAGAATAACGAAATTGGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_061890.12-1353s21c1
Sequence:CCGGAGTTGGTTTCACGATGATTTACTCGAGTAAATCATCGTGAAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-453s21c1
Sequence:CCGGAGAGACAAGAAACAATCTAAACTCGAGTTTAGATTGTTTCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-484s21c1
Sequence:CCGGAGAACATTTCATTCGTTAAAGCTCGAGCTTTAACGAATGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-1139s21c1
Sequence:CCGGCAAAGAGGAGCAATCACTATACTCGAGTATAGTGATTGCTCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061890
TRIM64 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 64
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-1087s21c1
Sequence:CCGGGCAGATGCCAATTTCGTTATTCTCGAGAATAACGAAATTGGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_061890.12-1353s21c1
Sequence:CCGGAGTTGGTTTCACGATGATTTACTCGAGTAAATCATCGTGAAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-453s21c1
Sequence:CCGGAGAGACAAGAAACAATCTAAACTCGAGTTTAGATTGTTTCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-484s21c1
Sequence:CCGGAGAACATTTCATTCGTTAAAGCTCGAGCTTTAACGAATGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_061890.12-1139s21c1
Sequence:CCGGCAAAGAGGAGCAATCACTATACTCGAGTATAGTGATTGCTCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks