EMAIL THIS PAGE TO A FRIEND

TRIM64B

tripartite motif containing 64B

Species: Human TRIM64B(642446)
UniProtKB ID: A6NI03
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001717781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001717781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001717781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717781 Rosetta Predictions human pricing
XM_001732877 Rosetta Predictions human pricing
XM_925959 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419465 predicted 638
2 SASI_Hs02_00419466 predicted 517
3 SASI_Hs02_00419467 predicted 470
4 SASI_Hs02_00419468 predicted 752
5 SASI_Hs02_00419469 predicted 807
6 SASI_Hs02_00419470 predicted 519
7 SASI_Hs02_00419471 predicted 509
8 SASI_Hs02_00419472 predicted 873
9 SASI_Hs02_00419473 predicted 430
10 SASI_Hs02_00419474 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001732877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478538 predicted 202
2 SASI_Hs02_00478539 predicted 205
3 SASI_Hs02_00478540 predicted 311
4 SASI_Hs02_00478541 predicted 256
5 SASI_Hs02_00478542 predicted 315
6 SASI_Hs02_00478543 predicted 317
7 SASI_Hs02_00478544 predicted 320
8 SASI_Hs02_00478545 predicted 271
9 SASI_Hs02_00478546 predicted 242
10 SASI_Hs02_00478547 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480258 predicted 470
2 SASI_Hs02_00480259 predicted 738
3 SASI_Hs02_00480260 predicted 521
4 SASI_Hs02_00480261 predicted 402
5 SASI_Hs02_00480262 predicted 522
6 SASI_Hs02_00480263 predicted 509
7 SASI_Hs02_00480264 predicted 872
8 SASI_Hs02_00480265 predicted 1387
9 SASI_Hs02_00480266 predicted 1440
10 SASI_Hs02_00480267 predicted 1362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001717781
TRIM64B MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 64B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001717781.1-1362s21c1
Sequence:CCGGCACGATGATTTATTGTGACCTCTCGAGAGGTCACAATAAATCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-910s21c1
Sequence:CCGGGATGTGAGATATGTGATATTTCTCGAGAAATATCACATATCTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-1059s21c1
Sequence:CCGGTCTGGGAGTCTGTCGAGATTCCTCGAGGAATCTCGACAGACTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-483s21c1
Sequence:CCGGTAGCACATTTCATTCGTTAAACTCGAGTTTAACGAATGAAATGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-520s21c1
Sequence:CCGGAGGAAGAGGATAATCACTATTCTCGAGAATAGTGATTATCCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001717781
TRIM64B MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 64B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001717781.1-1362s21c1
Sequence:CCGGCACGATGATTTATTGTGACCTCTCGAGAGGTCACAATAAATCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-910s21c1
Sequence:CCGGGATGTGAGATATGTGATATTTCTCGAGAAATATCACATATCTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-1059s21c1
Sequence:CCGGTCTGGGAGTCTGTCGAGATTCCTCGAGGAATCTCGACAGACTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-483s21c1
Sequence:CCGGTAGCACATTTCATTCGTTAAACTCGAGTTTAACGAATGAAATGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-520s21c1
Sequence:CCGGAGGAAGAGGATAATCACTATTCTCGAGAATAGTGATTATCCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001717781
TRIM64B MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 64B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001717781.1-1362s21c1
Sequence:CCGGCACGATGATTTATTGTGACCTCTCGAGAGGTCACAATAAATCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-910s21c1
Sequence:CCGGGATGTGAGATATGTGATATTTCTCGAGAAATATCACATATCTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-1059s21c1
Sequence:CCGGTCTGGGAGTCTGTCGAGATTCCTCGAGGAATCTCGACAGACTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-483s21c1
Sequence:CCGGTAGCACATTTCATTCGTTAAACTCGAGTTTAACGAATGAAATGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717781.1-520s21c1
Sequence:CCGGAGGAAGAGGATAATCACTATTCTCGAGAATAGTGATTATCCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks