EMAIL THIS PAGE TO A FRIEND

TRIM65

tripartite motif containing 65

Synonyms: 4732463G12Rik
UniProtKB ID: Q6PJ69, Q4G0F0, Q6DKJ6, Q9BRP6
Gene ID:
Mouse(338364) tripartite motif-containing 65
Rat(303684) tripartite motif-containing 65
chicken(417367) tripartite motif containing 65
domestic cat(101095699) tripartite motif containing 65
dog(609505) tripartite motif containing 65
cow(618637) tripartite motif containing 65
sheep(101107878) tripartite motif containing 65
naked mole-rat(101702138) tripartite motif containing 65
domestic guinea pig(100720472) tripartite motif containing 65
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173547 Rosetta Predictions human pricing
XM_001081711 Rosetta Predictions rat pricing
XM_221125 Rosetta Predictions rat pricing
NM_178802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112574 predicted 1212
2 SASI_Hs01_00112575 predicted 629
3 SASI_Hs02_00368354 predicted 1866
4 SASI_Hs01_00112576 predicted 617
5 SASI_Hs01_00112577 predicted 866
6 SASI_Hs01_00112578 predicted 1681
7 SASI_Hs01_00112579 predicted 1815
8 SASI_Hs01_00112580 predicted 1914
9 SASI_Hs01_00112581 predicted 1001
10 SASI_Hs01_00112582 predicted 1011
11 SASI_Hs01_00112583 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373125 predicted 1354
2 SASI_Rn02_00373126 predicted 1815
3 SASI_Rn02_00373127 predicted 1093
4 SASI_Rn02_00373128 predicted 1531
5 SASI_Rn02_00373129 predicted 1000
6 SASI_Rn02_00373130 predicted 926
7 SASI_Rn02_00373131 predicted 1528
8 SASI_Rn02_00373132 predicted 1487
9 SASI_Rn02_00373133 predicted 1799
10 SASI_Rn02_00373134 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379884 predicted 560
2 SASI_Rn02_00379885 predicted 1816
3 SASI_Rn02_00379886 predicted 1520
4 SASI_Rn02_00379887 predicted 1571
5 SASI_Rn02_00379888 predicted 1529
6 SASI_Rn02_00379889 predicted 1521
7 SASI_Rn02_00379890 predicted 1492
8 SASI_Rn02_00379891 predicted 1801
9 SASI_Rn02_00379892 predicted 1478
10 SASI_Rn02_00379893 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092590 predicted 1892
2 SASI_Mm01_00092591 predicted 976
3 SASI_Mm01_00092593 predicted 1111
4 SASI_Mm01_00092594 predicted 1310
5 SASI_Mm02_00349407 predicted 624
6 SASI_Mm01_00092595 predicted 1033
7 SASI_Mm01_00092596 predicted 1324
8 SASI_Mm01_00092597 predicted 1467
9 SASI_Mm01_00092598 predicted 1143
10 SASI_Mm01_00092599 predicted 1894
11 SASI_Mm01_00092592 predicted 1703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178802
TRIM65 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 65
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178802.4-1408s21c1
Sequence:CCGGTGCATCCAGGAGGACAGTATGCTCGAGCATACTGTCCTCCTGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1977s21c1
Sequence:CCGGCTATAGAAGAAAGCGTTTAACCTCGAGGTTAAACGCTTTCTTCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1912s21c1
Sequence:CCGGTTGCGTGGACATCTATCTTAGCTCGAGCTAAGATAGATGTCCACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1806s21c1
Sequence:CCGGGGAGCCTTAGAACAAAGTTTACTCGAGTAAACTTTGTTCTAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178802.2-2722s1c1
Sequence:CCGGCGTGGGTAAACATCTCACAAACTCGAGTTTGTGAGATGTTTACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1564s1c1
Sequence:CCGGCCTGGGCGTAGATTTGAACTTCTCGAGAAGTTCAAATCTACGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1231s1c1
Sequence:CCGGCGCCAACCAGTATTTGCACTTCTCGAGAAGTGCAAATACTGGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1189s1c1
Sequence:CCGGGCTCTGGCAGAATTATCGCAACTCGAGTTGCGATAATTCTGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1633s1c1
Sequence:CCGGGCTGCACACTTTCTATGCAGTCTCGAGACTGCATAGAAAGTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178802
TRIM65 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 65
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178802.4-1408s21c1
Sequence:CCGGTGCATCCAGGAGGACAGTATGCTCGAGCATACTGTCCTCCTGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1977s21c1
Sequence:CCGGCTATAGAAGAAAGCGTTTAACCTCGAGGTTAAACGCTTTCTTCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1912s21c1
Sequence:CCGGTTGCGTGGACATCTATCTTAGCTCGAGCTAAGATAGATGTCCACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1806s21c1
Sequence:CCGGGGAGCCTTAGAACAAAGTTTACTCGAGTAAACTTTGTTCTAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178802.2-2722s1c1
Sequence:CCGGCGTGGGTAAACATCTCACAAACTCGAGTTTGTGAGATGTTTACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1564s1c1
Sequence:CCGGCCTGGGCGTAGATTTGAACTTCTCGAGAAGTTCAAATCTACGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1231s1c1
Sequence:CCGGCGCCAACCAGTATTTGCACTTCTCGAGAAGTGCAAATACTGGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1189s1c1
Sequence:CCGGGCTCTGGCAGAATTATCGCAACTCGAGTTGCGATAATTCTGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1633s1c1
Sequence:CCGGGCTGCACACTTTCTATGCAGTCTCGAGACTGCATAGAAAGTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178802
TRIM65 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 65
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178802.4-1408s21c1
Sequence:CCGGTGCATCCAGGAGGACAGTATGCTCGAGCATACTGTCCTCCTGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1977s21c1
Sequence:CCGGCTATAGAAGAAAGCGTTTAACCTCGAGGTTAAACGCTTTCTTCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1912s21c1
Sequence:CCGGTTGCGTGGACATCTATCTTAGCTCGAGCTAAGATAGATGTCCACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178802.4-1806s21c1
Sequence:CCGGGGAGCCTTAGAACAAAGTTTACTCGAGTAAACTTTGTTCTAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178802.2-2722s1c1
Sequence:CCGGCGTGGGTAAACATCTCACAAACTCGAGTTTGTGAGATGTTTACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1564s1c1
Sequence:CCGGCCTGGGCGTAGATTTGAACTTCTCGAGAAGTTCAAATCTACGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1231s1c1
Sequence:CCGGCGCCAACCAGTATTTGCACTTCTCGAGAAGTGCAAATACTGGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1189s1c1
Sequence:CCGGGCTCTGGCAGAATTATCGCAACTCGAGTTGCGATAATTCTGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178802.2-1633s1c1
Sequence:CCGGGCTGCACACTTTCTATGCAGTCTCGAGACTGCATAGAAAGTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173547
VALIDATED
TRIM65 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 65
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173547.2-1013s21c1
Sequence:CCGGTCTGGCAGAATTATCGCAATCCTCGAGGATTGCGATAATTCTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173547.2-1053s21c1
Sequence:CCGGCGCCAACCGTCACTTCTATCTCTCGAGAGATAGAAGTGACGGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173547.2-2697s21c1
Sequence:CCGGCCTTGAGTCAAGCCGACTAAGCTCGAGCTTAGTCGGCTTGACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173547.2-513s21c1
Sequence:CCGGACTAGAGCTGCGCAAGCAAAGCTCGAGCTTTGCTTGCGCAGCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-607s1c1
Sequence:CCGGCTGGAAATACAGCACACGACACTCGAGTGTCGTGTGCTGTATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2256s1c1
Sequence:CCGGCCTCCAGAGTAGCTCAGATTACTCGAGTAATCTGAGCTACTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-857s1c1
Sequence:CCGGGTGACCTGAAGCAGTTGCTAACTCGAGTTAGCAACTGCTTCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-1020s1c1
Sequence:CCGGGAATTATCGCAATCTGACCTTCTCGAGAAGGTCAGATTGCGATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2556s1c1
Sequence:CCGGGCCTGGCTTATGATGAATATTCTCGAGAATATTCATCATAAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-1029s1c1
Sequence:CCGGCAATCTGACCTTTGATCCAGTCTCGAGACTGGATCAAAGGTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-991s1c1
Sequence:CCGGGTTTGTCCACTGAGGAGGAAACTCGAGTTTCCTCCTCAGTGGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2061s1c1
Sequence:CCGGCCGTCCTGTCTTGTAGTCTTTCTCGAGAAAGACTACAAGACAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173547
VALIDATED
TRIM65 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 65
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173547.2-1013s21c1
Sequence:CCGGTCTGGCAGAATTATCGCAATCCTCGAGGATTGCGATAATTCTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173547.2-1053s21c1
Sequence:CCGGCGCCAACCGTCACTTCTATCTCTCGAGAGATAGAAGTGACGGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173547.2-2697s21c1
Sequence:CCGGCCTTGAGTCAAGCCGACTAAGCTCGAGCTTAGTCGGCTTGACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173547.2-513s21c1
Sequence:CCGGACTAGAGCTGCGCAAGCAAAGCTCGAGCTTTGCTTGCGCAGCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-607s1c1
Sequence:CCGGCTGGAAATACAGCACACGACACTCGAGTGTCGTGTGCTGTATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2256s1c1
Sequence:CCGGCCTCCAGAGTAGCTCAGATTACTCGAGTAATCTGAGCTACTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-857s1c1
Sequence:CCGGGTGACCTGAAGCAGTTGCTAACTCGAGTTAGCAACTGCTTCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-1020s1c1
Sequence:CCGGGAATTATCGCAATCTGACCTTCTCGAGAAGGTCAGATTGCGATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2556s1c1
Sequence:CCGGGCCTGGCTTATGATGAATATTCTCGAGAATATTCATCATAAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-1029s1c1
Sequence:CCGGCAATCTGACCTTTGATCCAGTCTCGAGACTGGATCAAAGGTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-991s1c1
Sequence:CCGGGTTTGTCCACTGAGGAGGAAACTCGAGTTTCCTCCTCAGTGGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2061s1c1
Sequence:CCGGCCGTCCTGTCTTGTAGTCTTTCTCGAGAAAGACTACAAGACAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173547
VALIDATED
TRIM65 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 65
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173547.2-1013s21c1
Sequence:CCGGTCTGGCAGAATTATCGCAATCCTCGAGGATTGCGATAATTCTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173547.2-1053s21c1
Sequence:CCGGCGCCAACCGTCACTTCTATCTCTCGAGAGATAGAAGTGACGGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173547.2-2697s21c1
Sequence:CCGGCCTTGAGTCAAGCCGACTAAGCTCGAGCTTAGTCGGCTTGACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173547.2-513s21c1
Sequence:CCGGACTAGAGCTGCGCAAGCAAAGCTCGAGCTTTGCTTGCGCAGCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-607s1c1
Sequence:CCGGCTGGAAATACAGCACACGACACTCGAGTGTCGTGTGCTGTATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2256s1c1
Sequence:CCGGCCTCCAGAGTAGCTCAGATTACTCGAGTAATCTGAGCTACTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-857s1c1
Sequence:CCGGGTGACCTGAAGCAGTTGCTAACTCGAGTTAGCAACTGCTTCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-1020s1c1
Sequence:CCGGGAATTATCGCAATCTGACCTTCTCGAGAAGGTCAGATTGCGATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2556s1c1
Sequence:CCGGGCCTGGCTTATGATGAATATTCTCGAGAATATTCATCATAAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-1029s1c1
Sequence:CCGGCAATCTGACCTTTGATCCAGTCTCGAGACTGGATCAAAGGTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173547.2-991s1c1
Sequence:CCGGGTTTGTCCACTGAGGAGGAAACTCGAGTTTCCTCCTCAGTGGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173547.2-2061s1c1
Sequence:CCGGCCGTCCTGTCTTGTAGTCTTTCTCGAGAAAGACTACAAGACAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks