EMAIL THIS PAGE TO A FRIEND

TRIM66

tripartite motif containing 66

Synonyms: C11orf29 TIF1D TIF1DELTA
UniProtKB ID: O15016, Q9BQQ4
Gene ID:
Mouse(330627) tripartite motif-containing 66
Rat(361623) tripartite motif-containing 66
domestic guinea pig(100731794) tripartite motif containing 66
naked mole-rat(101724553) tripartite motif containing 66
Domestic Rabbit(100343276) tripartite motif containing 66
cow(520781) tripartite motif containing 66
sheep(101102263) tripartite motif containing 66
Zebrafish(566719) tripartite motif-containing 66
chicken(423056) tripartite motif containing 66
Horse(100070991) tripartite motif containing 66
domestic cat(101083962) tripartite motif containing 66
dog(485379) tripartite motif containing 66
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027420 Anti-TRIM66 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106937 Anti-TRIM66 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_001716253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001716253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001716253 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716253 Rosetta Predictions human pricing
XM_001716830 Rosetta Predictions human pricing
XM_001717903 Rosetta Predictions human pricing
XM_084529 Rosetta Predictions human pricing
XM_001072969 Rosetta Predictions rat pricing
XM_341901 Rosetta Predictions rat pricing
NM_181853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00409294 predicted 2873
2 SASI_Hs02_00409295 predicted 3671
3 SASI_Hs02_00409296 predicted 2726
4 SASI_Hs02_00409297 predicted 3093
5 SASI_Hs02_00409298 predicted 3396
6 SASI_Hs02_00409299 predicted 3643
7 SASI_Hs02_00409300 predicted 902
8 SASI_Hs02_00409301 predicted 4066
9 SASI_Hs02_00409302 predicted 4058
10 SASI_Hs02_00409303 predicted 3036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413235 predicted 2872
2 SASI_Hs02_00413236 predicted 3670
3 SASI_Hs02_00413237 predicted 2725
4 SASI_Hs02_00413238 predicted 3092
5 SASI_Hs02_00413239 predicted 3392
6 SASI_Hs02_00413240 predicted 3648
7 SASI_Hs02_00413241 predicted 904
8 SASI_Hs02_00413242 predicted 4061
9 SASI_Hs02_00413243 predicted 4061
10 SASI_Hs02_00413244 predicted 3036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00420341 predicted 2717
2 SASI_Hs02_00420342 predicted 3507
3 SASI_Hs02_00420343 predicted 2568
4 SASI_Hs02_00420344 predicted 2937
5 SASI_Hs02_00420345 predicted 3232
6 SASI_Hs02_00420346 predicted 3491
7 SASI_Hs02_00420347 predicted 748
8 SASI_Hs02_00420348 predicted 3907
9 SASI_Hs02_00420349 predicted 3905
10 SASI_Hs02_00420350 predicted 2875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_084529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275080 predicted 2718
2 SASI_Hs01_00275081 predicted 3512
3 SASI_Hs01_00275082 predicted 2575
4 SASI_Hs01_00275083 predicted 2945
5 SASI_Hs01_00275084 predicted 3245
6 SASI_Hs01_00275085 predicted 3905
7 SASI_Hs01_00275086 predicted 3495
8 SASI_Hs01_00275087 predicted 754
9 SASI_Hs01_00275088 predicted 3908
10 SASI_Hs01_00275089 predicted 3099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341179 predicted 3036
2 SASI_Rn02_00341180 predicted 1502
3 SASI_Rn02_00341181 predicted 3895
4 SASI_Rn02_00341182 predicted 2982
5 SASI_Rn02_00341183 predicted 3382
6 SASI_Rn02_00341184 predicted 1119
7 SASI_Rn02_00341185 predicted 845
8 SASI_Rn02_00341186 predicted 1207
9 SASI_Rn02_00341187 predicted 1045
10 SASI_Rn02_00341188 predicted 3984
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393553 predicted 3030
2 SASI_Rn02_00393554 predicted 2918
3 SASI_Rn02_00393555 predicted 925
4 SASI_Rn02_00393556 predicted 1118
5 SASI_Rn02_00393557 predicted 981
6 SASI_Rn02_00393558 predicted 2143
7 SASI_Rn02_00393559 predicted 2958
8 SASI_Rn02_00393560 predicted 1053
9 SASI_Rn02_00393561 predicted 936
10 SASI_Rn02_00393562 predicted 3100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090806 predicted 3272
2 SASI_Mm01_00090808 predicted 4283
3 SASI_Mm01_00090809 predicted 2913
4 SASI_Mm01_00090810 predicted 4345
5 SASI_Mm01_00090811 predicted 4318
6 SASI_Mm01_00090812 predicted 3214
7 SASI_Mm01_00090813 predicted 2543
8 SASI_Mm01_00090814 predicted 3618
9 SASI_Mm01_00090815 predicted 4037
10 SASI_Mm02_00349939 predicted 646
11 SASI_Mm01_00090807 predicted 3952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181853
TRIM66 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 66
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181853.2-9035s1c1
Sequence:CCGGCGCTGCTTCATTGAGCCATATCTCGAGATATGGCTCAATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-1363s1c1
Sequence:CCGGGCTGCCTCTTATGGGAGTTTACTCGAGTAAACTCCCATAAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-2555s1c1
Sequence:CCGGCCAGCCTGATGAGTGTTTCAACTCGAGTTGAAACACTCATCAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-886s1c1
Sequence:CCGGGCACATAAGAAATCCAGCCTACTCGAGTAGGCTGGATTTCTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-3827s1c1
Sequence:CCGGCCAGGCATTATTACCAGATTACTCGAGTAATCTGGTAATAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181853
TRIM66 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 66
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181853.2-9035s1c1
Sequence:CCGGCGCTGCTTCATTGAGCCATATCTCGAGATATGGCTCAATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-1363s1c1
Sequence:CCGGGCTGCCTCTTATGGGAGTTTACTCGAGTAAACTCCCATAAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-2555s1c1
Sequence:CCGGCCAGCCTGATGAGTGTTTCAACTCGAGTTGAAACACTCATCAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-886s1c1
Sequence:CCGGGCACATAAGAAATCCAGCCTACTCGAGTAGGCTGGATTTCTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-3827s1c1
Sequence:CCGGCCAGGCATTATTACCAGATTACTCGAGTAATCTGGTAATAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181853
TRIM66 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 66
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181853.2-9035s1c1
Sequence:CCGGCGCTGCTTCATTGAGCCATATCTCGAGATATGGCTCAATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-1363s1c1
Sequence:CCGGGCTGCCTCTTATGGGAGTTTACTCGAGTAAACTCCCATAAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-2555s1c1
Sequence:CCGGCCAGCCTGATGAGTGTTTCAACTCGAGTTGAAACACTCATCAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-886s1c1
Sequence:CCGGGCACATAAGAAATCCAGCCTACTCGAGTAGGCTGGATTTCTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181853.2-3827s1c1
Sequence:CCGGCCAGGCATTATTACCAGATTACTCGAGTAATCTGGTAATAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001716253
TRIM66 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 66
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001716253.1-5480s21c1
Sequence:CCGGCTGTCATTGCATGGCTAATTTCTCGAGAAATTAGCCATGCAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-3544s21c1
Sequence:CCGGCGGCATTATTACCAGATTATCCTCGAGGATAATCTGGTAATAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-500s21c1
Sequence:CCGGCCGGAGACTTCACCTTGTATTCTCGAGAATACAAGGTGAAGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-3397s21c1
Sequence:CCGGTGTGAGAATGCCTGCTATAACCTCGAGGTTATAGCAGGCATTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-2879s21c1
Sequence:CCGGTCAATAGTGAGCATAAGATTCCTCGAGGAATCTTATGCTCACTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001716253
TRIM66 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 66
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001716253.1-5480s21c1
Sequence:CCGGCTGTCATTGCATGGCTAATTTCTCGAGAAATTAGCCATGCAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-3544s21c1
Sequence:CCGGCGGCATTATTACCAGATTATCCTCGAGGATAATCTGGTAATAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-500s21c1
Sequence:CCGGCCGGAGACTTCACCTTGTATTCTCGAGAATACAAGGTGAAGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-3397s21c1
Sequence:CCGGTGTGAGAATGCCTGCTATAACCTCGAGGTTATAGCAGGCATTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-2879s21c1
Sequence:CCGGTCAATAGTGAGCATAAGATTCCTCGAGGAATCTTATGCTCACTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001716253
TRIM66 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 66
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001716253.1-5480s21c1
Sequence:CCGGCTGTCATTGCATGGCTAATTTCTCGAGAAATTAGCCATGCAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-3544s21c1
Sequence:CCGGCGGCATTATTACCAGATTATCCTCGAGGATAATCTGGTAATAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-500s21c1
Sequence:CCGGCCGGAGACTTCACCTTGTATTCTCGAGAATACAAGGTGAAGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-3397s21c1
Sequence:CCGGTGTGAGAATGCCTGCTATAACCTCGAGGTTATAGCAGGCATTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716253.1-2879s21c1
Sequence:CCGGTCAATAGTGAGCATAAGATTCCTCGAGGAATCTTATGCTCACTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks