EMAIL THIS PAGE TO A FRIEND

TRIM67

tripartite motif containing 67

Synonyms: TNL
UniProtKB ID: Q6ZTA4, Q5TER7, Q5TER8, Q7Z4K7
Gene ID:
Mouse(330863) tripartite motif-containing 67
Rat(307938) tripartite motif-containing 67
chicken(100857188) tripartite motif containing 67
domestic cat(101090967) tripartite motif containing 67
Horse(100051245) tripartite motif containing 67
dog(608010) tripartite motif containing 67
cow(518459) tripartite motif containing 67
sheep(101113651) tripartite motif containing 67
Domestic Rabbit(100354206) tripartite motif containing 67
naked mole-rat(101712408) tripartite motif containing 67
domestic guinea pig(100726575) tripartite motif containing 67
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004342 Rosetta Predictions human pricing
XM_001054626 Rosetta Predictions rat pricing
XM_226563 Rosetta Predictions rat pricing
XM_001480316 Rosetta Predictions mouse pricing
XM_001480318 Rosetta Predictions mouse pricing
XM_001480431 Rosetta Predictions mouse pricing
XM_001480436 Rosetta Predictions mouse pricing
XM_001480440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226202 predicted 1779
2 SASI_Hs01_00226203 predicted 1786
3 SASI_Hs01_00226204 predicted 1778
4 SASI_Hs01_00226205 predicted 1596
5 SASI_Hs01_00226206 predicted 1483
6 SASI_Hs02_00304562 predicted 2340
7 SASI_Hs01_00226207 predicted 1706
8 SASI_Hs01_00226208 predicted 1135
9 SASI_Hs01_00226209 predicted 1094
10 SASI_Hs01_00226210 predicted 1095
11 SASI_Hs01_00226211 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276567 predicted 2834
2 SASI_Rn02_00276568 predicted 2855
3 SASI_Rn02_00276569 predicted 2481
4 SASI_Rn02_00276570 predicted 2275
5 SASI_Rn02_00276571 predicted 1864
6 SASI_Rn02_00276572 predicted 2276
7 SASI_Rn02_00276573 predicted 1531
8 SASI_Rn02_00276574 predicted 2577
9 SASI_Rn02_00276575 predicted 1524
10 SASI_Rn02_00276576 predicted 2155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383665 predicted 2477
2 SASI_Rn02_00383666 predicted 2500
3 SASI_Rn02_00383667 predicted 2124
4 SASI_Rn02_00383668 predicted 1924
5 SASI_Rn02_00383669 predicted 1508
6 SASI_Rn02_00383670 predicted 1915
7 SASI_Rn02_00383671 predicted 1177
8 SASI_Rn02_00383672 predicted 2215
9 SASI_Rn02_00383673 predicted 1173
10 SASI_Rn02_00383674 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416608 predicted 1476
2 SASI_Mm02_00416609 predicted 1782
3 SASI_Mm02_00416610 predicted 1563
4 SASI_Mm02_00416611 predicted 1782
5 SASI_Mm02_00416612 predicted 1446
6 SASI_Mm02_00416613 predicted 1200
7 SASI_Mm02_00416614 predicted 869
8 SASI_Mm02_00416615 predicted 1794
9 SASI_Mm02_00416616 predicted 1818
10 SASI_Mm02_00416617 predicted 2170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416628 predicted 1473
2 SASI_Mm02_00416629 predicted 1784
3 SASI_Mm02_00416630 predicted 1780
4 SASI_Mm02_00416631 predicted 1452
5 SASI_Mm02_00416632 predicted 1202
6 SASI_Mm02_00416633 predicted 1550
7 SASI_Mm02_00416634 predicted 870
8 SASI_Mm02_00416635 predicted 1793
9 SASI_Mm02_00416636 predicted 1823
10 SASI_Mm02_00416637 predicted 2168
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417555 predicted 242
2 SASI_Mm02_00417556 predicted 2286
3 SASI_Mm02_00417557 predicted 434
4 SASI_Mm02_00417558 predicted 1194
5 SASI_Mm02_00417559 predicted 862
6 SASI_Mm02_00417560 predicted 1855
7 SASI_Mm02_00417561 predicted 1996
8 SASI_Mm02_00417562 predicted 1152
9 SASI_Mm02_00417563 predicted 1373
10 SASI_Mm02_00417564 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417591 predicted 893
2 SASI_Mm02_00417592 predicted 1980
3 SASI_Mm02_00417593 predicted 2039
4 SASI_Mm02_00417594 predicted 878
5 SASI_Mm02_00417595 predicted 1856
6 SASI_Mm02_00417596 predicted 1542
7 SASI_Mm02_00417597 predicted 1684
8 SASI_Mm02_00417598 predicted 1054
9 SASI_Mm02_00417599 predicted 1895
10 SASI_Mm02_00417600 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417628 predicted 1053
2 SASI_Mm02_00417629 predicted 1542
3 SASI_Mm02_00417630 predicted 888
4 SASI_Mm02_00417631 predicted 886
5 SASI_Mm02_00417632 predicted 1053
6 SASI_Mm02_00417633 predicted 1029
7 SASI_Mm02_00417634 predicted 2074
8 SASI_Mm02_00417635 predicted 2109
9 SASI_Mm02_00417636 predicted 1001
10 SASI_Mm02_00417637 predicted 1532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004342
TRIM67 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 67
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004342.2-3690s1c1
Sequence:CCGGGCTGTGGATGTTCCACTGAAACTCGAGTTTCAGTGGAACATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1237s1c1
Sequence:CCGGGATGCTTTAACTCGTCAGAAACTCGAGTTTCTGACGAGTTAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1102s1c1
Sequence:CCGGGCCTTAAATGGAGTTTCAGATCTCGAGATCTGAAACTCCATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1155s1c1
Sequence:CCGGGCTAAAGAACATATTGCAGCACTCGAGTGCTGCAATATGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004342.2-2815s1c1
Sequence:CCGGGCCTTCTTTGTTACCTAAGTTCTCGAGAACTTAGGTAACAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004342
TRIM67 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 67
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004342.2-3690s1c1
Sequence:CCGGGCTGTGGATGTTCCACTGAAACTCGAGTTTCAGTGGAACATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1237s1c1
Sequence:CCGGGATGCTTTAACTCGTCAGAAACTCGAGTTTCTGACGAGTTAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1102s1c1
Sequence:CCGGGCCTTAAATGGAGTTTCAGATCTCGAGATCTGAAACTCCATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1155s1c1
Sequence:CCGGGCTAAAGAACATATTGCAGCACTCGAGTGCTGCAATATGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004342.2-2815s1c1
Sequence:CCGGGCCTTCTTTGTTACCTAAGTTCTCGAGAACTTAGGTAACAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004342
TRIM67 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 67
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004342.2-3690s1c1
Sequence:CCGGGCTGTGGATGTTCCACTGAAACTCGAGTTTCAGTGGAACATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1237s1c1
Sequence:CCGGGATGCTTTAACTCGTCAGAAACTCGAGTTTCTGACGAGTTAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1102s1c1
Sequence:CCGGGCCTTAAATGGAGTTTCAGATCTCGAGATCTGAAACTCCATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004342.2-1155s1c1
Sequence:CCGGGCTAAAGAACATATTGCAGCACTCGAGTGCTGCAATATGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004342.2-2815s1c1
Sequence:CCGGGCCTTCTTTGTTACCTAAGTTCTCGAGAACTTAGGTAACAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks