EMAIL THIS PAGE TO A FRIEND

TRIM68

tripartite motif containing 68

Synonyms: GC109 RNF137 SS-56 SS56
Gene ID:
Human(55128) Summary: This gene encodes a protein which contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene is expressed in many cancer cell lines. Its expression in normal tissues, however, was found to be restricted to prostate. This gene was also found to be differentially expressed in androgen-dependent versus androgen-independent prostate cancer cells. [provided by RefSeq, Oct 2011]
Mouse(101700) tripartite motif-containing 68
Rat(684189) tripartite motif containing 68
domestic guinea pig(100720935) tripartite motif containing 68
cow(538657) tripartite motif containing 68
sheep(101113359) tripartite motif containing 68
Horse(100053519) tripartite motif containing 68
domestic cat(101089893) tripartite motif containing 68
dog(485233) tripartite motif containing 68
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018073 Rosetta Predictions human pricing
NM_198012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351216 predicted 1181
2 SASI_Hs01_00126286 predicted 1012
3 SASI_Hs01_00126287 predicted 750
4 SASI_Hs01_00126288 predicted 1112
5 SASI_Hs02_00351217 predicted 1064
6 SASI_Hs01_00126289 predicted 642
7 SASI_Hs01_00126290 predicted 1405
8 SASI_Hs01_00126291 predicted 555
9 SASI_Hs02_00351218 predicted 1506
10 SASI_Hs01_00126293 predicted 1146
11 SASI_Hs01_00126284 predicted 1079
12 SASI_Hs01_00126285 predicted 788
13 SASI_Hs01_00126292 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088511 predicted 624
2 SASI_Mm01_00088513 predicted 480
3 SASI_Mm01_00088514 predicted 607
4 SASI_Mm01_00088516 predicted 1080
5 SASI_Mm01_00088517 predicted 1483
6 SASI_Mm01_00088518 predicted 414
7 SASI_Mm01_00088520 predicted 1158
8 SASI_Mm02_00350723 predicted 244
9 SASI_Mm02_00350724 predicted 1397
10 SASI_Mm02_00350725 predicted 256
11 SASI_Mm01_00088512 predicted 881
12 SASI_Mm01_00088515 predicted 996
13 SASI_Mm01_00088519 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018073
VALIDATED
TRIM68 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 68
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018073.5-1350s1c1
Sequence:CCGGGCCTGGGAGTATGTAAGCAAACTCGAGTTTGCTTACATACTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018073.5-1019s1c1
Sequence:CCGGCAGGATATTCAGGAAGTGTTACTCGAGTAACACTTCCTGAATATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018073.5-1266s1c1
Sequence:CCGGGCTATAATATCGTCCTGGGAACTCGAGTTCCCAGGACGATATTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-1150s21c1
Sequence:CCGGTGTGCGCTTGGATCCAGATACCTCGAGGTATCTGGATCCAAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018073.5-565s21c1
Sequence:CCGGCAAAGAGGATGTCTTGATAATCTCGAGATTATCAAGACATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018073.5-1855s21c1
Sequence:CCGGCTGTCATGAAACCACTTATTTCTCGAGAAATAAGTGGTTTCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-782s21c1
Sequence:CCGGCAGAGTATTGTATGGGAGTTTCTCGAGAAACTCCCATACAATACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-1506s21c1
Sequence:CCGGTGGGAATCTTCGTGGATTATGCTCGAGCATAATCCACGAAGATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018073
VALIDATED
TRIM68 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 68
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018073.5-1350s1c1
Sequence:CCGGGCCTGGGAGTATGTAAGCAAACTCGAGTTTGCTTACATACTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018073.5-1019s1c1
Sequence:CCGGCAGGATATTCAGGAAGTGTTACTCGAGTAACACTTCCTGAATATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018073.5-1266s1c1
Sequence:CCGGGCTATAATATCGTCCTGGGAACTCGAGTTCCCAGGACGATATTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-1150s21c1
Sequence:CCGGTGTGCGCTTGGATCCAGATACCTCGAGGTATCTGGATCCAAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018073.5-565s21c1
Sequence:CCGGCAAAGAGGATGTCTTGATAATCTCGAGATTATCAAGACATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018073.5-1855s21c1
Sequence:CCGGCTGTCATGAAACCACTTATTTCTCGAGAAATAAGTGGTTTCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-782s21c1
Sequence:CCGGCAGAGTATTGTATGGGAGTTTCTCGAGAAACTCCCATACAATACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-1506s21c1
Sequence:CCGGTGGGAATCTTCGTGGATTATGCTCGAGCATAATCCACGAAGATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018073
VALIDATED
TRIM68 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 68
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018073.5-1350s1c1
Sequence:CCGGGCCTGGGAGTATGTAAGCAAACTCGAGTTTGCTTACATACTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018073.5-1019s1c1
Sequence:CCGGCAGGATATTCAGGAAGTGTTACTCGAGTAACACTTCCTGAATATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018073.5-1266s1c1
Sequence:CCGGGCTATAATATCGTCCTGGGAACTCGAGTTCCCAGGACGATATTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-1150s21c1
Sequence:CCGGTGTGCGCTTGGATCCAGATACCTCGAGGTATCTGGATCCAAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018073.5-565s21c1
Sequence:CCGGCAAAGAGGATGTCTTGATAATCTCGAGATTATCAAGACATCCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018073.5-1855s21c1
Sequence:CCGGCTGTCATGAAACCACTTATTTCTCGAGAAATAAGTGGTTTCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-782s21c1
Sequence:CCGGCAGAGTATTGTATGGGAGTTTCTCGAGAAACTCCCATACAATACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018073.5-1506s21c1
Sequence:CCGGTGGGAATCTTCGTGGATTATGCTCGAGCATAATCCACGAAGATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198012
TRIM68 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 68
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-1529s1c1
Sequence:CCGGGCCCTATTTCAGTCCTTGCTACTCGAGTAGCAAGGACTGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-564s1c1
Sequence:CCGGGCCTGGGAATATAAGTGGAAACTCGAGTTTCCACTTATATTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-535s1c1
Sequence:CCGGCCCACAGTGTTGTACCCATAACTCGAGTTATGGGTACAACACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-478s1c1
Sequence:CCGGGCAAGGAGGATGATATGGTAACTCGAGTTACCATATCATCCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-1570s1c1
Sequence:CCGGCCACTCCACTCACCATTTGTACTCGAGTACAAATGGTGAGTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198012
TRIM68 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 68
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-1529s1c1
Sequence:CCGGGCCCTATTTCAGTCCTTGCTACTCGAGTAGCAAGGACTGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-564s1c1
Sequence:CCGGGCCTGGGAATATAAGTGGAAACTCGAGTTTCCACTTATATTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-535s1c1
Sequence:CCGGCCCACAGTGTTGTACCCATAACTCGAGTTATGGGTACAACACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-478s1c1
Sequence:CCGGGCAAGGAGGATGATATGGTAACTCGAGTTACCATATCATCCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-1570s1c1
Sequence:CCGGCCACTCCACTCACCATTTGTACTCGAGTACAAATGGTGAGTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198012
TRIM68 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 68
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-1529s1c1
Sequence:CCGGGCCCTATTTCAGTCCTTGCTACTCGAGTAGCAAGGACTGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-564s1c1
Sequence:CCGGGCCTGGGAATATAAGTGGAAACTCGAGTTTCCACTTATATTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-535s1c1
Sequence:CCGGCCCACAGTGTTGTACCCATAACTCGAGTTATGGGTACAACACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-478s1c1
Sequence:CCGGGCAAGGAGGATGATATGGTAACTCGAGTTACCATATCATCCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198012.1-1570s1c1
Sequence:CCGGCCACTCCACTCACCATTTGTACTCGAGTACAAATGGTGAGTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks