EMAIL THIS PAGE TO A FRIEND

TRIM69

tripartite motif containing 69

Synonyms: HSD34 RNF36 Trif
Gene ID:
Human(140691) Summary: This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(70928) tripartite motif-containing 69
Rat(311373) tripartite motif-containing 69
Zebrafish(322138) tripartite motif-containing 69
Horse(100056035) tripartite motif containing 69
domestic cat(101092613) tripartite motif containing 69
dog(478285) tripartite motif containing 69
chicken(427640) tripartite motif containing 69
cow(618372) tripartite motif containing 69
sheep(101120839) tripartite motif containing 69
domestic guinea pig(100732949) tripartite motif containing 69
naked mole-rat(101700450) tripartite motif containing 69
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080745 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092821 MISSION® esiRNA esiRNA human TRIM69 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080745 Rosetta Predictions human pricing
NM_182985 Rosetta Predictions human pricing
NM_001013160 Rosetta Predictions rat pricing
NM_080510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246861 predicted 1136
2 SASI_Hs01_00246862 predicted 1191
3 SASI_Hs01_00246863 predicted 652
4 SASI_Hs01_00246864 predicted 1032
5 SASI_Hs01_00246865 predicted 556
6 SASI_Hs01_00246866 predicted 1001
7 SASI_Hs02_00362543 predicted 1137
8 SASI_Hs01_00246867 predicted 862
9 SASI_Hs01_00246868 predicted 711
10 SASI_Hs01_00246869 predicted 1037
11 SASI_Hs01_00246870 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033642 predicted 1616
2 SASI_Hs01_00033643 predicted 1664
3 SASI_Hs01_00033644 predicted 1122
4 SASI_Hs01_00033645 predicted 1504
5 SASI_Hs01_00033646 predicted 1027
6 SASI_Hs01_00033647 predicted 1485
7 SASI_Hs02_00371157 predicted 1620
8 SASI_Hs01_00033648 predicted 1335
9 SASI_Hs01_00033649 predicted 1184
10 SASI_Hs01_00033650 predicted 1517
11 SASI_Hs01_00033651 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068553 predicted 423
2 SASI_Rn01_00068554 predicted 482
3 SASI_Rn01_00068555 predicted 1113
4 SASI_Rn01_00068557 predicted 637
5 SASI_Rn01_00068558 predicted 492
6 SASI_Rn01_00068559 predicted 990
7 SASI_Rn01_00068560 predicted 1349
8 SASI_Rn01_00068561 predicted 1280
9 SASI_Rn02_00200898 predicted 897
10 SASI_Rn01_00068562 predicted 911
11 SASI_Rn01_00068556 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054064 predicted 1453
2 SASI_Mm01_00054065 predicted 230
3 SASI_Mm02_00338149 predicted 1248
4 SASI_Mm02_00338150 predicted 460
5 SASI_Mm01_00054066 predicted 1332
6 SASI_Mm01_00054067 predicted 960
7 SASI_Mm02_00338151 predicted 1233
8 SASI_Mm01_00054068 predicted 1119
9 SASI_Mm01_00054070 predicted 772
10 SASI_Mm01_00054071 predicted 1013
11 SASI_Mm01_00054069 predicted 1092
12 SASI_Mm01_00054072 predicted 748
13 SASI_Mm01_00054073 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080745
VALIDATED
TRIM69 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 69
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-726s21c1
Sequence:CCGGTGGCAACCAGAGAGCTTATTTCTCGAGAAATAAGCTCTCTGGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_080745.3-897s21c1
Sequence:CCGGGCGTCTGGCATGGTGACATTACTCGAGTAATGTCACCATGCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1184s21c1
Sequence:CCGGCTCGACAAGGTGGGCATATACCTCGAGGTATATGCCCACCTTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1047s21c1
Sequence:GTACCGGTTGTCAGAGAATCCATCATTCCTCGAGGAATGATGGATTCTCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1121s21c1
Sequence:GTACCGGAGGAACCAAACTGATCTAAAGCTCGAGCTTTAGATCAGTTTGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-674s1c1
Sequence:CCGGCCACTAACTCTGGACCCTAAACTCGAGTTTAGGGTCCAGAGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-742s1c1
Sequence:CCGGGCATGGTGACATTAAGAAGATCTCGAGATCTTCTTAATGTCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-245s1c1
Sequence:CCGGCTGAGGAACATGCAGAAGGAACTCGAGTTCCTTCTGCATGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-1031s1c1
Sequence:CCGGGTGGGCATATACCTGGATTATCTCGAGATAATCCAGGTATATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-570s1c1
Sequence:CCGGCCAGAGAGCTTATTTCCAGAACTCGAGTTCTGGAAATAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080745
VALIDATED
TRIM69 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 69
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-726s21c1
Sequence:CCGGTGGCAACCAGAGAGCTTATTTCTCGAGAAATAAGCTCTCTGGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_080745.3-897s21c1
Sequence:CCGGGCGTCTGGCATGGTGACATTACTCGAGTAATGTCACCATGCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1184s21c1
Sequence:CCGGCTCGACAAGGTGGGCATATACCTCGAGGTATATGCCCACCTTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1047s21c1
Sequence:GTACCGGTTGTCAGAGAATCCATCATTCCTCGAGGAATGATGGATTCTCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1121s21c1
Sequence:GTACCGGAGGAACCAAACTGATCTAAAGCTCGAGCTTTAGATCAGTTTGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-674s1c1
Sequence:CCGGCCACTAACTCTGGACCCTAAACTCGAGTTTAGGGTCCAGAGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-742s1c1
Sequence:CCGGGCATGGTGACATTAAGAAGATCTCGAGATCTTCTTAATGTCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-245s1c1
Sequence:CCGGCTGAGGAACATGCAGAAGGAACTCGAGTTCCTTCTGCATGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-1031s1c1
Sequence:CCGGGTGGGCATATACCTGGATTATCTCGAGATAATCCAGGTATATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-570s1c1
Sequence:CCGGCCAGAGAGCTTATTTCCAGAACTCGAGTTCTGGAAATAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080745
VALIDATED
TRIM69 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 69
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-726s21c1
Sequence:CCGGTGGCAACCAGAGAGCTTATTTCTCGAGAAATAAGCTCTCTGGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_080745.3-897s21c1
Sequence:CCGGGCGTCTGGCATGGTGACATTACTCGAGTAATGTCACCATGCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1184s21c1
Sequence:CCGGCTCGACAAGGTGGGCATATACCTCGAGGTATATGCCCACCTTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1047s21c1
Sequence:GTACCGGTTGTCAGAGAATCCATCATTCCTCGAGGAATGATGGATTCTCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080745.3-1121s21c1
Sequence:GTACCGGAGGAACCAAACTGATCTAAAGCTCGAGCTTTAGATCAGTTTGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-674s1c1
Sequence:CCGGCCACTAACTCTGGACCCTAAACTCGAGTTTAGGGTCCAGAGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-742s1c1
Sequence:CCGGGCATGGTGACATTAAGAAGATCTCGAGATCTTCTTAATGTCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-245s1c1
Sequence:CCGGCTGAGGAACATGCAGAAGGAACTCGAGTTCCTTCTGCATGTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-1031s1c1
Sequence:CCGGGTGGGCATATACCTGGATTATCTCGAGATAATCCAGGTATATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080745.2-570s1c1
Sequence:CCGGCCAGAGAGCTTATTTCCAGAACTCGAGTTCTGGAAATAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080510
TRIM69 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 69
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-666s1c1
Sequence:CCGGCGTTTCTTTACGGAGGAGCTTCTCGAGAAGCTCCTCCGTAAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1188s1c1
Sequence:CCGGGCTCATCCCAATCTGGTGTTACTCGAGTAACACCAGATTGGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-488s1c1
Sequence:CCGGGCTCGTGGAGAAGATTAAGAACTCGAGTTCTTAATCTTCTCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1019s1c1
Sequence:CCGGGCTCATAGAGAGCATGGAGAACTCGAGTTCTCCATGCTCTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1544s1c1
Sequence:CCGGCGGGCAAGTATCCTTCTACAACTCGAGTTGTAGAAGGATACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080510
TRIM69 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 69
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-666s1c1
Sequence:CCGGCGTTTCTTTACGGAGGAGCTTCTCGAGAAGCTCCTCCGTAAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1188s1c1
Sequence:CCGGGCTCATCCCAATCTGGTGTTACTCGAGTAACACCAGATTGGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-488s1c1
Sequence:CCGGGCTCGTGGAGAAGATTAAGAACTCGAGTTCTTAATCTTCTCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1019s1c1
Sequence:CCGGGCTCATAGAGAGCATGGAGAACTCGAGTTCTCCATGCTCTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1544s1c1
Sequence:CCGGCGGGCAAGTATCCTTCTACAACTCGAGTTGTAGAAGGATACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080510
TRIM69 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 69
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-666s1c1
Sequence:CCGGCGTTTCTTTACGGAGGAGCTTCTCGAGAAGCTCCTCCGTAAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1188s1c1
Sequence:CCGGGCTCATCCCAATCTGGTGTTACTCGAGTAACACCAGATTGGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-488s1c1
Sequence:CCGGGCTCGTGGAGAAGATTAAGAACTCGAGTTCTTAATCTTCTCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1019s1c1
Sequence:CCGGGCTCATAGAGAGCATGGAGAACTCGAGTTCTCCATGCTCTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080510.1-1544s1c1
Sequence:CCGGCGGGCAAGTATCCTTCTACAACTCGAGTTGTAGAAGGATACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks