EMAIL THIS PAGE TO A FRIEND

TRIM6

tripartite motif containing 6

Synonyms: RNF89
UniProtKB ID: Q9C030, A8K2A7, B4DDQ5, Q86WZ8, Q9HCR1
Gene ID:
Human(117854) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Mouse(94088) tripartite motif-containing 6
Rat(293294) tripartite motif containing 6
Horse(100568303) tripartite motif containing 6
domestic cat(101094788) tripartite motif containing 6
dog(100568301) tripartite motif containing 6
Domestic Rabbit(100328879) tripartite motif containing 6
domestic guinea pig(100716342) tripartite motif containing 6
cow(514492) tripartite motif containing 6
sheep(101103179) tripartite motif containing 6
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU204281 MISSION® esiRNA esiRNA targeting mouse Trim6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003818 Rosetta Predictions human pricing
NM_058166 Rosetta Predictions human pricing
XM_001073689 Rosetta Predictions rat pricing
XM_219045 Rosetta Predictions rat pricing
NM_001013616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304403 predicted 1127
2 SASI_Hs01_00197998 predicted 979
3 SASI_Hs01_00197999 predicted 879
4 SASI_Hs01_00198000 predicted 1516
5 SASI_Hs01_00198001 predicted 1231
6 SASI_Hs01_00198002 predicted 601
7 SASI_Hs01_00198003 predicted 456
8 SASI_Hs01_00198004 predicted 1552
9 SASI_Hs01_00198005 predicted 887
10 SASI_Hs01_00198006 predicted 1505
11 SASI_Hs01_00197997 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143727 predicted 1102
2 SASI_Hs01_00143728 predicted 940
3 SASI_Hs01_00143729 predicted 778
4 SASI_Hs01_00143730 predicted 684
5 SASI_Hs01_00143731 predicted 1326
6 SASI_Hs01_00143732 predicted 1036
7 SASI_Hs01_00143733 predicted 399
8 SASI_Hs01_00143734 predicted 1349
9 SASI_Hs01_00143735 predicted 699
10 SASI_Hs01_00143736 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343565 predicted 2325
2 SASI_Rn02_00343566 predicted 2629
3 SASI_Rn02_00343567 predicted 1854
4 SASI_Rn02_00343568 predicted 1554
5 SASI_Rn02_00343569 predicted 2082
6 SASI_Rn02_00343570 predicted 2281
7 SASI_Rn02_00343571 predicted 2055
8 SASI_Rn02_00343572 predicted 1510
9 SASI_Rn02_00343573 predicted 1469
10 SASI_Rn02_00343574 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378267 predicted 1722
2 SASI_Rn02_00378268 predicted 2234
3 SASI_Rn02_00378269 predicted 1760
4 SASI_Rn02_00378270 predicted 1471
5 SASI_Rn02_00378271 predicted 1993
6 SASI_Rn02_00378272 predicted 2199
7 SASI_Rn02_00378273 predicted 1965
8 SASI_Rn02_00378274 predicted 1421
9 SASI_Rn02_00378275 predicted 2150
10 SASI_Rn02_00378276 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103821 predicted 1343
2 SASI_Mm01_00103822 predicted 1013
3 SASI_Mm01_00103823 predicted 1334
4 SASI_Mm01_00103824 predicted 250
5 SASI_Mm01_00103825 predicted 1496
6 SASI_Mm01_00103826 predicted 228
7 SASI_Mm01_00103827 predicted 1146
8 SASI_Mm01_00103828 predicted 1269
9 SASI_Mm01_00103829 predicted 1216
10 SASI_Mm01_00103830 predicted 1483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058166
VALIDATED
TRIM6 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1517s1c1
Sequence:CCGGCCACTACTCTTTGTCCATATTCTCGAGAATATGGACAAAGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1090s1c1
Sequence:CCGGGTGAGGTTTGTGGGAGCTAAACTCGAGTTTAGCTCCCACAAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1486s1c1
Sequence:CCGGCCCATCTACACTTTCTCTAAACTCGAGTTTAGAGAAAGTGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-229s1c1
Sequence:CCGGCAAGCCTGCATCACACCAAATCTCGAGATTTGGTGTGATGCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-561s1c1
Sequence:CCGGGTCTCTAAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1526s21c1
Sequence:CCGGCCACTACTCTTTGTCCATATTCTCGAGAATATGGACAAAGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1099s21c1
Sequence:CCGGGTGAGGTTTGTGGGAGCTAAACTCGAGTTTAGCTCCCACAAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-570s21c1
Sequence:CCGGGTCTCTAAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1047s21c1
Sequence:CCGGGAATCCACACACAGCTAATTTCTCGAGAAATTAGCTGTGTGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058166.3-2055s21c1
Sequence:CCGGTGGTGAGAGTAAGCATCTTTGCTCGAGCAAAGATGCTTACTCTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058166
VALIDATED
TRIM6 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1517s1c1
Sequence:CCGGCCACTACTCTTTGTCCATATTCTCGAGAATATGGACAAAGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1090s1c1
Sequence:CCGGGTGAGGTTTGTGGGAGCTAAACTCGAGTTTAGCTCCCACAAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1486s1c1
Sequence:CCGGCCCATCTACACTTTCTCTAAACTCGAGTTTAGAGAAAGTGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-229s1c1
Sequence:CCGGCAAGCCTGCATCACACCAAATCTCGAGATTTGGTGTGATGCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-561s1c1
Sequence:CCGGGTCTCTAAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1526s21c1
Sequence:CCGGCCACTACTCTTTGTCCATATTCTCGAGAATATGGACAAAGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1099s21c1
Sequence:CCGGGTGAGGTTTGTGGGAGCTAAACTCGAGTTTAGCTCCCACAAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-570s21c1
Sequence:CCGGGTCTCTAAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1047s21c1
Sequence:CCGGGAATCCACACACAGCTAATTTCTCGAGAAATTAGCTGTGTGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058166.3-2055s21c1
Sequence:CCGGTGGTGAGAGTAAGCATCTTTGCTCGAGCAAAGATGCTTACTCTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058166
VALIDATED
TRIM6 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1517s1c1
Sequence:CCGGCCACTACTCTTTGTCCATATTCTCGAGAATATGGACAAAGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1090s1c1
Sequence:CCGGGTGAGGTTTGTGGGAGCTAAACTCGAGTTTAGCTCCCACAAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-1486s1c1
Sequence:CCGGCCCATCTACACTTTCTCTAAACTCGAGTTTAGAGAAAGTGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-229s1c1
Sequence:CCGGCAAGCCTGCATCACACCAAATCTCGAGATTTGGTGTGATGCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_058166.2-561s1c1
Sequence:CCGGGTCTCTAAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1526s21c1
Sequence:CCGGCCACTACTCTTTGTCCATATTCTCGAGAATATGGACAAAGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1099s21c1
Sequence:CCGGGTGAGGTTTGTGGGAGCTAAACTCGAGTTTAGCTCCCACAAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-570s21c1
Sequence:CCGGGTCTCTAAAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTTTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058166.3-1047s21c1
Sequence:CCGGGAATCCACACACAGCTAATTTCTCGAGAAATTAGCTGTGTGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058166.3-2055s21c1
Sequence:CCGGTGGTGAGAGTAAGCATCTTTGCTCGAGCAAAGATGCTTACTCTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013616
VALIDATED
TRIM6 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013616.1-2382s1c1
Sequence:CCGGCCTCTGAATTAGATAGGAATTCTCGAGAATTCCTATCTAATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-1042s1c1
Sequence:CCGGCAGACGGCTAATTTAAATCTTCTCGAGAAGATTTAAATTAGCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013616.1-1482s1c1
Sequence:CCGGGCCCATCTACACCTTCTCGAACTCGAGTTCGAGAAGGTGTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-663s1c1
Sequence:CCGGCCGGATCCAGACAGAGTTTAACTCGAGTTAAACTCTGTCTGGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-225s1c1
Sequence:CCGGCCAGGTCTGCATCATAGGAAACTCGAGTTTCCTATGATGCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1055s21c1
Sequence:CCGGGAATCCACAGACGGCTAATTTCTCGAGAAATTAGCCGTCTGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013616.2-2000s21c1
Sequence:CCGGACTGATCCAGAGTCCCGATTACTCGAGTAATCGGGACTCTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1426s21c1
Sequence:CCGGCACCTCGACGCATAGGGATTTCTCGAGAAATCCCTATGCGTCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1502s21c1
Sequence:CCGGGCCCATCTACACCTTCTCGAACTCGAGTTCGAGAAGGTGTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-254s21c1
Sequence:CCGGCATCATAGGAAACAGTAATAACTCGAGTTATTACTGTTTCCTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013616
VALIDATED
TRIM6 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013616.1-2382s1c1
Sequence:CCGGCCTCTGAATTAGATAGGAATTCTCGAGAATTCCTATCTAATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-1042s1c1
Sequence:CCGGCAGACGGCTAATTTAAATCTTCTCGAGAAGATTTAAATTAGCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013616.1-1482s1c1
Sequence:CCGGGCCCATCTACACCTTCTCGAACTCGAGTTCGAGAAGGTGTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-663s1c1
Sequence:CCGGCCGGATCCAGACAGAGTTTAACTCGAGTTAAACTCTGTCTGGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-225s1c1
Sequence:CCGGCCAGGTCTGCATCATAGGAAACTCGAGTTTCCTATGATGCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1055s21c1
Sequence:CCGGGAATCCACAGACGGCTAATTTCTCGAGAAATTAGCCGTCTGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013616.2-2000s21c1
Sequence:CCGGACTGATCCAGAGTCCCGATTACTCGAGTAATCGGGACTCTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1426s21c1
Sequence:CCGGCACCTCGACGCATAGGGATTTCTCGAGAAATCCCTATGCGTCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1502s21c1
Sequence:CCGGGCCCATCTACACCTTCTCGAACTCGAGTTCGAGAAGGTGTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-254s21c1
Sequence:CCGGCATCATAGGAAACAGTAATAACTCGAGTTATTACTGTTTCCTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013616
VALIDATED
TRIM6 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013616.1-2382s1c1
Sequence:CCGGCCTCTGAATTAGATAGGAATTCTCGAGAATTCCTATCTAATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-1042s1c1
Sequence:CCGGCAGACGGCTAATTTAAATCTTCTCGAGAAGATTTAAATTAGCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013616.1-1482s1c1
Sequence:CCGGGCCCATCTACACCTTCTCGAACTCGAGTTCGAGAAGGTGTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-663s1c1
Sequence:CCGGCCGGATCCAGACAGAGTTTAACTCGAGTTAAACTCTGTCTGGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013616.1-225s1c1
Sequence:CCGGCCAGGTCTGCATCATAGGAAACTCGAGTTTCCTATGATGCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1055s21c1
Sequence:CCGGGAATCCACAGACGGCTAATTTCTCGAGAAATTAGCCGTCTGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013616.2-2000s21c1
Sequence:CCGGACTGATCCAGAGTCCCGATTACTCGAGTAATCGGGACTCTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1426s21c1
Sequence:CCGGCACCTCGACGCATAGGGATTTCTCGAGAAATCCCTATGCGTCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-1502s21c1
Sequence:CCGGGCCCATCTACACCTTCTCGAACTCGAGTTCGAGAAGGTGTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013616.2-254s21c1
Sequence:CCGGCATCATAGGAAACAGTAATAACTCGAGTTATTACTGTTTCCTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks