EMAIL THIS PAGE TO A FRIEND

TRIM71

tripartite motif containing 71, E3 ubiquitin protein ligase

Synonyms: LIN-41 LIN41
UniProtKB ID: Q2Q1W2
Gene ID:
Mouse(636931) tripartite motif-containing 71
Rat(301042) tripartite motif containing 71, E3 ubiquitin protein ligase
Zebrafish(561754) tripartite motif-containing 71
domestic cat(101096006) tripartite motif containing 71, E3 ubiquitin protein ligase
dog(477014) tripartite motif containing 71, E3 ubiquitin protein ligase
chicken(428445) tripartite motif containing 71, E3 ubiquitin protein ligase
cow(531886) tripartite motif containing 71, E3 ubiquitin protein ligase
sheep(101112682) tripartite motif containing 71, E3 ubiquitin protein ligase
domestic guinea pig(100721907) tripartite motif containing 71, E3 ubiquitin protein ligase
naked mole-rat(101711956) tripartite motif containing 71, E3 ubiquitin protein ligase
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0119 AQUA Peptide SFGFVSSGAFAPLT[K] cow, dog, human, rat pricing
AQ0070 AQUA Peptide ALDILLA[R] cow, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039111 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU171381 MISSION® esiRNA esiRNA targeting mouse Trim71 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039111 Rosetta Predictions human pricing
XM_001076764 Rosetta Predictions rat pricing
XM_236676 Rosetta Predictions rat pricing
NM_001042503 Rosetta Predictions mouse pricing
XM_912489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191176 predicted 2481
2 SASI_Hs01_00191177 predicted 1448
3 SASI_Hs01_00191178 predicted 920
4 SASI_Hs01_00191179 predicted 1462
5 SASI_Hs01_00191180 predicted 1070
6 SASI_Hs01_00191181 predicted 1699
7 SASI_Hs01_00191182 predicted 2339
8 SASI_Hs01_00191183 predicted 2403
9 SASI_Hs01_00191184 predicted 2080
10 SASI_Hs01_00191185 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354464 predicted 1759
2 SASI_Rn02_00354465 predicted 1554
3 SASI_Rn02_00354466 predicted 2295
4 SASI_Rn02_00354467 predicted 878
5 SASI_Rn02_00354468 predicted 2003
6 SASI_Rn02_00354469 predicted 1543
7 SASI_Rn02_00354470 predicted 1725
8 SASI_Rn02_00354471 predicted 2165
9 SASI_Rn02_00354472 predicted 1025
10 SASI_Rn02_00354473 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390329 predicted 1845
2 SASI_Rn02_00390330 predicted 1644
3 SASI_Rn02_00390331 predicted 2378
4 SASI_Rn02_00390332 predicted 965
5 SASI_Rn02_00390333 predicted 2089
6 SASI_Rn02_00390334 predicted 1810
7 SASI_Rn02_00390335 predicted 1561
8 SASI_Rn02_00390336 predicted 2260
9 SASI_Rn02_00390337 predicted 1117
10 SASI_Rn02_00390338 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290485 predicted 3625
2 SASI_Mm02_00290486 predicted 3047
3 SASI_Mm02_00290487 predicted 3101
4 SASI_Mm02_00290488 predicted 2898
5 SASI_Mm02_00290489 predicted 3344
6 SASI_Mm02_00290490 predicted 3207
7 SASI_Mm02_00290491 predicted 3236
8 SASI_Mm02_00290492 predicted 3219
9 SASI_Mm02_00290493 predicted 3294
10 SASI_Mm02_00290494 predicted 3349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224317 predicted 1592
2 SASI_Mm01_00224318 predicted 1797
3 SASI_Mm01_00224319 predicted 2076
4 SASI_Mm01_00224320 predicted 1656
5 SASI_Mm01_00224321 predicted 2099
6 SASI_Mm01_00224322 predicted 1953
7 SASI_Mm01_00224323 predicted 1993
8 SASI_Mm01_00224324 predicted 1971
9 SASI_Mm01_00224325 predicted 2048
10 SASI_Mm01_00224326 predicted 2105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042503
TRIM71 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 71, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4055s21c1
Sequence:CCGGTGAGCCTGTGAAGTGATAATTCTCGAGAATTATCACTTCACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4641s21c1
Sequence:CCGGTTTGCTAAGAAACTCGATTTACTCGAGTAAATCGAGTTTCTTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4275s21c1
Sequence:CCGGATGTTGGAAAGATAGGATTTACTCGAGTAAATCCTATCTTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4322s21c1
Sequence:CCGGTTCTTGAGAATACTGTGTTTACTCGAGTAAACACAGTATTCTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4663s21c1
Sequence:CCGGCTCAGGACTCTAGGTTGAAAGCTCGAGCTTTCAACCTAGAGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042503
TRIM71 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 71, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4055s21c1
Sequence:CCGGTGAGCCTGTGAAGTGATAATTCTCGAGAATTATCACTTCACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4641s21c1
Sequence:CCGGTTTGCTAAGAAACTCGATTTACTCGAGTAAATCGAGTTTCTTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4275s21c1
Sequence:CCGGATGTTGGAAAGATAGGATTTACTCGAGTAAATCCTATCTTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4322s21c1
Sequence:CCGGTTCTTGAGAATACTGTGTTTACTCGAGTAAACACAGTATTCTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4663s21c1
Sequence:CCGGCTCAGGACTCTAGGTTGAAAGCTCGAGCTTTCAACCTAGAGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042503
TRIM71 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 71, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4055s21c1
Sequence:CCGGTGAGCCTGTGAAGTGATAATTCTCGAGAATTATCACTTCACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4641s21c1
Sequence:CCGGTTTGCTAAGAAACTCGATTTACTCGAGTAAATCGAGTTTCTTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4275s21c1
Sequence:CCGGATGTTGGAAAGATAGGATTTACTCGAGTAAATCCTATCTTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4322s21c1
Sequence:CCGGTTCTTGAGAATACTGTGTTTACTCGAGTAAACACAGTATTCTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042503.1-4663s21c1
Sequence:CCGGCTCAGGACTCTAGGTTGAAAGCTCGAGCTTTCAACCTAGAGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039111
TRIM71 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 71, E3 ubiquitin protein ligase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-2537s21c1
Sequence:CCGGGCAGCTTCCTGTGCAAGTTTGCTCGAGCAAACTTGCACAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039111.1-2896s21c1
Sequence:CCGGTGAGCCTGTGAAGTGATAATTCTCGAGAATTATCACTTCACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-1907s21c1
Sequence:CCGGACAAGGAGGGCTACATCATTGCTCGAGCAATGATGTAGCCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-2658s21c1
Sequence:CCGGCCTCGTCTTCTAATTGCATTTCTCGAGAAATGCAATTAGAAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039111
TRIM71 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 71, E3 ubiquitin protein ligase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-2537s21c1
Sequence:CCGGGCAGCTTCCTGTGCAAGTTTGCTCGAGCAAACTTGCACAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039111.1-2896s21c1
Sequence:CCGGTGAGCCTGTGAAGTGATAATTCTCGAGAATTATCACTTCACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-1907s21c1
Sequence:CCGGACAAGGAGGGCTACATCATTGCTCGAGCAATGATGTAGCCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-2658s21c1
Sequence:CCGGCCTCGTCTTCTAATTGCATTTCTCGAGAAATGCAATTAGAAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039111
TRIM71 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 71, E3 ubiquitin protein ligase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-2537s21c1
Sequence:CCGGGCAGCTTCCTGTGCAAGTTTGCTCGAGCAAACTTGCACAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039111.1-2896s21c1
Sequence:CCGGTGAGCCTGTGAAGTGATAATTCTCGAGAATTATCACTTCACAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-1907s21c1
Sequence:CCGGACAAGGAGGGCTACATCATTGCTCGAGCAATGATGTAGCCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039111.1-2658s21c1
Sequence:CCGGCCTCGTCTTCTAATTGCATTTCTCGAGAAATGCAATTAGAAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks