EMAIL THIS PAGE TO A FRIEND

TRIM72

tripartite motif containing 72

Synonyms: MG53
UniProtKB ID: Q6ZMU5, Q8N4X6, Q8NBD9
Gene ID:
Mouse(434246) tripartite motif-containing 72
Rat(365377) tripartite motif-containing 72
naked mole-rat(101718040) tripartite motif containing 72
domestic guinea pig(100718437) tripartite motif containing 72
cow(528804) tripartite motif containing 72
sheep(101106488) tripartite motif containing 72
domestic cat(101088203) tripartite motif containing 72
dog(489927) tripartite motif containing 72
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108735 Anti-TRIM72 affinity isolated antibody rabbit, mouse, pig, human, rat, canine, guinea pig, horse, canine
western blot pricing
SAB2102571 Anti-TRIM72 (ab1) antibody produced in rabbit affinity isolated antibody human, mouse, canine, horse, rabbit, rat, guinea pig, bovine, rabbit
western blot pricing
SAB2102572 Anti-TRIM72 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, human, rabbit, rabbit, rat, bovine, mouse, canine, horse
western blot pricing
SAB2501571 Anti-TRIM72 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1400878 Anti-TRIM72 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA023122 Anti-TRIM72 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1408704 Anti-TRIM72 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA054909 Anti-TRIM72 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1403510 Monoclonal Anti-TRIM72, (C-terminal) antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001079932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001079932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008274 Rosetta Predictions human pricing
NM_001077675 Rosetta Predictions rat pricing
NM_001079932 Rosetta Predictions mouse pricing
XM_486011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198886 predicted 1018
2 SASI_Hs01_00198887 predicted 1020
3 SASI_Hs01_00198888 predicted 912
4 SASI_Hs02_00305414 predicted 653
5 SASI_Hs01_00198889 predicted 1061
6 SASI_Hs01_00198891 predicted 926
7 SASI_Hs01_00198892 predicted 311
8 SASI_Hs01_00198893 predicted 286
9 SASI_Hs01_00198894 predicted 1012
10 SASI_Hs01_00198895 predicted 1008
11 SASI_Hs01_00198890 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207872 predicted 1694
2 SASI_Rn02_00207873 predicted 1563
3 SASI_Rn02_00207874 predicted 703
4 SASI_Rn02_00207875 predicted 1698
5 SASI_Rn02_00207876 predicted 1360
6 SASI_Rn02_00207877 predicted 1808
7 SASI_Rn02_00207878 predicted 1801
8 SASI_Rn02_00207879 predicted 1577
9 SASI_Rn02_00207880 predicted 1666
10 SASI_Rn02_00207881 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293273 predicted 687
2 SASI_Mm02_00293274 predicted 1683
3 SASI_Mm02_00293275 predicted 1638
4 SASI_Mm02_00293276 predicted 622
5 SASI_Mm02_00293277 predicted 629
6 SASI_Mm02_00293278 predicted 1299
7 SASI_Mm02_00293279 predicted 1565
8 SASI_Mm02_00293280 predicted 571
9 SASI_Mm02_00293281 predicted 1479
10 SASI_Mm02_00293282 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211243 predicted 692
2 SASI_Mm01_00211244 predicted 620
3 SASI_Mm01_00211245 predicted 1302
4 SASI_Mm01_00211246 predicted 1728
5 SASI_Mm01_00211247 predicted 1566
6 SASI_Mm01_00211248 predicted 1640
7 SASI_Mm01_00211249 predicted 1666
8 SASI_Mm01_00211250 predicted 980
9 SASI_Mm01_00211251 predicted 1492
10 SASI_Mm01_00211252 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079932
TRIM72 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 72
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-807s21c1
Sequence:CCGGTCATCTCAGATGACTTCAAATCTCGAGATTTGAAGTCATCTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-1269s21c1
Sequence:CCGGATGGCGTCCTGGCTTTCTATGCTCGAGCATAGAAAGCCAGGACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-775s21c1
Sequence:CCGGACCACCGGCAAGGCTAGATATCTCGAGATATCTAGCCTTGCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079932.2-1921s21c1
Sequence:CCGGTGCTGGGTGCATGGCTATAATCTCGAGATTATAGCCATGCACCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-1026s21c1
Sequence:CCGGTGTCACAGGGCGAGCACTATTCTCGAGAATAGTGCTCGCCCTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079932
TRIM72 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 72
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-807s21c1
Sequence:CCGGTCATCTCAGATGACTTCAAATCTCGAGATTTGAAGTCATCTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-1269s21c1
Sequence:CCGGATGGCGTCCTGGCTTTCTATGCTCGAGCATAGAAAGCCAGGACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-775s21c1
Sequence:CCGGACCACCGGCAAGGCTAGATATCTCGAGATATCTAGCCTTGCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079932.2-1921s21c1
Sequence:CCGGTGCTGGGTGCATGGCTATAATCTCGAGATTATAGCCATGCACCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-1026s21c1
Sequence:CCGGTGTCACAGGGCGAGCACTATTCTCGAGAATAGTGCTCGCCCTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079932
TRIM72 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 72
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-807s21c1
Sequence:CCGGTCATCTCAGATGACTTCAAATCTCGAGATTTGAAGTCATCTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-1269s21c1
Sequence:CCGGATGGCGTCCTGGCTTTCTATGCTCGAGCATAGAAAGCCAGGACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-775s21c1
Sequence:CCGGACCACCGGCAAGGCTAGATATCTCGAGATATCTAGCCTTGCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079932.2-1921s21c1
Sequence:CCGGTGCTGGGTGCATGGCTATAATCTCGAGATTATAGCCATGCACCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079932.2-1026s21c1
Sequence:CCGGTGTCACAGGGCGAGCACTATTCTCGAGAATAGTGCTCGCCCTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008274
TRIM72 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 72
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008274.1-940s1c1
Sequence:CCGGCCTCATGAAATACTGCCTGGTCTCGAGACCAGGCAGTATTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-929s1c1
Sequence:CCGGCAGACTGAGTTCCTCATGAAACTCGAGTTTCATGAGGAACTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008274.1-1918s1c1
Sequence:CCGGGTGAAACTCCTCTCTACTGAACTCGAGTTCAGTAGAGAGGAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-1018s1c1
Sequence:CCGGCCAGCTGCCAATTATCTCAGACTCGAGTCTGAGATAATTGGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008274.1-1786s1c1
Sequence:CCGGGATCTCCCAGAATACTGACAACTCGAGTTGTCAGTATTCTGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-1465s1c1
Sequence:CCGGCATTGGCCTTTACCTGAGCTTCTCGAGAAGCTCAGGTAAAGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008274
TRIM72 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 72
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008274.1-940s1c1
Sequence:CCGGCCTCATGAAATACTGCCTGGTCTCGAGACCAGGCAGTATTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-929s1c1
Sequence:CCGGCAGACTGAGTTCCTCATGAAACTCGAGTTTCATGAGGAACTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008274.1-1918s1c1
Sequence:CCGGGTGAAACTCCTCTCTACTGAACTCGAGTTCAGTAGAGAGGAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-1018s1c1
Sequence:CCGGCCAGCTGCCAATTATCTCAGACTCGAGTCTGAGATAATTGGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008274.1-1786s1c1
Sequence:CCGGGATCTCCCAGAATACTGACAACTCGAGTTGTCAGTATTCTGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-1465s1c1
Sequence:CCGGCATTGGCCTTTACCTGAGCTTCTCGAGAAGCTCAGGTAAAGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008274
TRIM72 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 72
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008274.1-940s1c1
Sequence:CCGGCCTCATGAAATACTGCCTGGTCTCGAGACCAGGCAGTATTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-929s1c1
Sequence:CCGGCAGACTGAGTTCCTCATGAAACTCGAGTTTCATGAGGAACTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008274.1-1918s1c1
Sequence:CCGGGTGAAACTCCTCTCTACTGAACTCGAGTTCAGTAGAGAGGAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-1018s1c1
Sequence:CCGGCCAGCTGCCAATTATCTCAGACTCGAGTCTGAGATAATTGGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008274.1-1786s1c1
Sequence:CCGGGATCTCCCAGAATACTGACAACTCGAGTTGTCAGTATTCTGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008274.1-1465s1c1
Sequence:CCGGCATTGGCCTTTACCTGAGCTTCTCGAGAAGCTCAGGTAAAGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks