EMAIL THIS PAGE TO A FRIEND

TRIM73

tripartite motif containing 73

Synonyms: TRIM50B
Species: Human TRIM73(375593)
UniProtKB ID: Q86UV7, Q8N0S3
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198924 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198924 Rosetta Predictions human pricing
XM_351723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084924 predicted 255
2 SASI_Hs01_00084926 predicted 264
3 SASI_Hs02_00372412 predicted 895
4 SASI_Hs02_00372413 predicted 1169
5 SASI_Hs02_00372414 predicted 944
6 SASI_Hs02_00372415 predicted 1175
7 SASI_Hs02_00372416 predicted 926
8 SASI_Hs01_00084925 predicted 264
9 SASI_Hs01_00084927 predicted 698
10 SASI_Hs01_00084928 predicted 690
11 SASI_Hs01_00084929 predicted 662
12 SASI_Hs01_00084930 predicted 680
13 SASI_Hs01_00084931 predicted 530
14 SASI_Hs01_00084932 predicted 648
15 SASI_Hs01_00084933 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_351723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479219 predicted 200
2 SASI_Hs02_00479220 predicted 204
3 SASI_Hs02_00479221 predicted 835
4 SASI_Hs02_00479222 predicted 878
5 SASI_Hs02_00479223 predicted 888
6 SASI_Hs02_00479224 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198924
TRIM73 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 73
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-908s1c1
Sequence:CCGGCCACCATGAGTTCATCTGGAACTCGAGTTCCAGATGAACTCATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-920s1c1
Sequence:CCGGCATCTGGAAGTTCCACTCCATCTCGAGATGGAGTGGAACTTCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-899s1c1
Sequence:CCGGCAATGAGGACCACCATGAGTTCTCGAGAACTCATGGTGGTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198924.2-1193s1c1
Sequence:CCGGCAGAAATACTAGAGGAGGGTACTCGAGTACCCTCCTCTAGTATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198924.2-1179s1c1
Sequence:CCGGGTTCACTCAAGCTACAGAAATCTCGAGATTTCTGTAGCTTGAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198924.2-690s21c1
Sequence:CCGCATCGTCAATGAGTCGGATGTCCTCGAGGACATCCGACTCATTGACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198924.2-263s21c1
Sequence:CCGGGGTCTTCAAGGAGTCCCTAATCTCGAGATTAGGGACTCCTTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198924.2-1016s21c1
Sequence:CCGGGGTTCCTCCATTCAGCTTAACCTCGAGGTTAAGCTGAATGGAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198924
TRIM73 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 73
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-908s1c1
Sequence:CCGGCCACCATGAGTTCATCTGGAACTCGAGTTCCAGATGAACTCATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-920s1c1
Sequence:CCGGCATCTGGAAGTTCCACTCCATCTCGAGATGGAGTGGAACTTCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-899s1c1
Sequence:CCGGCAATGAGGACCACCATGAGTTCTCGAGAACTCATGGTGGTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198924.2-1193s1c1
Sequence:CCGGCAGAAATACTAGAGGAGGGTACTCGAGTACCCTCCTCTAGTATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198924.2-1179s1c1
Sequence:CCGGGTTCACTCAAGCTACAGAAATCTCGAGATTTCTGTAGCTTGAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198924.2-690s21c1
Sequence:CCGCATCGTCAATGAGTCGGATGTCCTCGAGGACATCCGACTCATTGACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198924.2-263s21c1
Sequence:CCGGGGTCTTCAAGGAGTCCCTAATCTCGAGATTAGGGACTCCTTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198924.2-1016s21c1
Sequence:CCGGGGTTCCTCCATTCAGCTTAACCTCGAGGTTAAGCTGAATGGAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198924
TRIM73 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 73
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-908s1c1
Sequence:CCGGCCACCATGAGTTCATCTGGAACTCGAGTTCCAGATGAACTCATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-920s1c1
Sequence:CCGGCATCTGGAAGTTCCACTCCATCTCGAGATGGAGTGGAACTTCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198924.2-899s1c1
Sequence:CCGGCAATGAGGACCACCATGAGTTCTCGAGAACTCATGGTGGTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198924.2-1193s1c1
Sequence:CCGGCAGAAATACTAGAGGAGGGTACTCGAGTACCCTCCTCTAGTATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198924.2-1179s1c1
Sequence:CCGGGTTCACTCAAGCTACAGAAATCTCGAGATTTCTGTAGCTTGAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198924.2-690s21c1
Sequence:CCGCATCGTCAATGAGTCGGATGTCCTCGAGGACATCCGACTCATTGACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198924.2-263s21c1
Sequence:CCGGGGTCTTCAAGGAGTCCCTAATCTCGAGATTAGGGACTCCTTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198924.2-1016s21c1
Sequence:CCGGGGTTCCTCCATTCAGCTTAACCTCGAGGTTAAGCTGAATGGAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks