EMAIL THIS PAGE TO A FRIEND

TRIM74

tripartite motif containing 74

Synonyms: TRIM50C
Species: Human TRIM74(378108)
UniProtKB ID: Q86UV6, B7WP46
Gene ID:
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198853 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU229871 MISSION® esiRNA esiRNA targeting human TRIM74 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198853 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239824 predicted 254
2 SASI_Hs01_00239825 predicted 264
3 SASI_Hs01_00239823 predicted 889
4 SASI_Hs02_00372368 predicted 1175
5 SASI_Hs02_00372369 predicted 941
6 SASI_Hs02_00372370 predicted 1175
7 SASI_Hs01_00239822 predicted 930
8 SASI_Hs01_00239826 predicted 938
9 SASI_Hs01_00239827 predicted 700
10 SASI_Hs01_00239828 predicted 691
11 SASI_Hs01_00239829 predicted 659
12 SASI_Hs01_00239830 predicted 881
13 SASI_Hs01_00239831 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198853
TRIM74 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 74
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198853.1-502s21c1
Sequence:CCGGAGAAGGACCAGGAGCTCATCTCTCGAGAGATGAGCTCCTGGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-911s1c1
Sequence:CCGGCCATGAGTTCATCTGGAAGTTCTCGAGAACTTCCAGATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-692s1c1
Sequence:CCGGCGTCAATGAGTCGGATGTCTTCTCGAGAAGACATCCGACTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-882s1c1
Sequence:CCGGGTGCTGGAACAGTTCGGAAATCTCGAGATTTCCGAACTGTTCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-657s1c1
Sequence:CCGGCTCATCGCCAAACTGGTGAAACTCGAGTTTCACCAGTTTGGCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-262s1c1
Sequence:CCGGAGGTCTTCAAGGAGTCCCTAACTCGAGTTAGGGACTCCTTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198853
TRIM74 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 74
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198853.1-502s21c1
Sequence:CCGGAGAAGGACCAGGAGCTCATCTCTCGAGAGATGAGCTCCTGGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-911s1c1
Sequence:CCGGCCATGAGTTCATCTGGAAGTTCTCGAGAACTTCCAGATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-692s1c1
Sequence:CCGGCGTCAATGAGTCGGATGTCTTCTCGAGAAGACATCCGACTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-882s1c1
Sequence:CCGGGTGCTGGAACAGTTCGGAAATCTCGAGATTTCCGAACTGTTCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-657s1c1
Sequence:CCGGCTCATCGCCAAACTGGTGAAACTCGAGTTTCACCAGTTTGGCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-262s1c1
Sequence:CCGGAGGTCTTCAAGGAGTCCCTAACTCGAGTTAGGGACTCCTTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198853
TRIM74 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 74
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198853.1-502s21c1
Sequence:CCGGAGAAGGACCAGGAGCTCATCTCTCGAGAGATGAGCTCCTGGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-911s1c1
Sequence:CCGGCCATGAGTTCATCTGGAAGTTCTCGAGAACTTCCAGATGAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-692s1c1
Sequence:CCGGCGTCAATGAGTCGGATGTCTTCTCGAGAAGACATCCGACTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-882s1c1
Sequence:CCGGGTGCTGGAACAGTTCGGAAATCTCGAGATTTCCGAACTGTTCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-657s1c1
Sequence:CCGGCTCATCGCCAAACTGGTGAAACTCGAGTTTCACCAGTTTGGCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198853.1-262s1c1
Sequence:CCGGAGGTCTTCAAGGAGTCCCTAACTCGAGTTAGGGACTCCTTGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks