EMAIL THIS PAGE TO A FRIEND

TRIM75

tripartite motif containing 75

UniProtKB ID: A6NK02
Gene ID:
Mouse(333307) tripartite motif-containing 75
Horse(100068191) tripartite motif-containing 75
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303929 ANTI-TRIM75 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373039 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001105575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105575 Rosetta Predictions human pricing
NM_001033429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324551 predicted 397
2 SASI_Hs02_00324552 predicted 728
3 SASI_Hs02_00324553 predicted 991
4 SASI_Hs02_00324554 predicted 695
5 SASI_Hs02_00324555 predicted 389
6 SASI_Hs02_00324556 predicted 453
7 SASI_Hs02_00324557 predicted 1074
8 SASI_Hs02_00324558 predicted 779
9 SASI_Hs02_00324559 predicted 503
10 SASI_Hs02_00324560 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288740 predicted 1288
2 SASI_Mm01_00143168 predicted 1749
3 SASI_Mm02_00288741 predicted 950
4 SASI_Mm01_00143170 predicted 908
5 SASI_Mm01_00143171 predicted 1767
6 SASI_Mm01_00143172 predicted 1321
7 SASI_Mm01_00143173 predicted 1723
8 SASI_Mm01_00143175 predicted 1428
9 SASI_Mm01_00143176 predicted 1617
10 SASI_Mm01_00143177 predicted 817
11 SASI_Mm01_00143169 predicted 1788
12 SASI_Mm01_00143174 predicted 1855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373039
TRIM75 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 75
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-648s1c1
Sequence:CCGGCAGTGCAAACATAACAGCATTCTCGAGAATGCTGTTATGTTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-541s1c1
Sequence:CCGGCAGGAATTATCCTCTGAATTTCTCGAGAAATTCAGAGGATAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-406s1c1
Sequence:CCGGGCTGCCATTCATTATAGGAAACTCGAGTTTCCTATAATGAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-1097s1c1
Sequence:CCGGGCAAAGATTCTCTTCCCACAACTCGAGTTGTGGGAAGAGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-1140s1c1
Sequence:CCGGCCAGCAGGAATGTTGGAGAATCTCGAGATTCTCCAACATTCCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373039
TRIM75 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 75
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-648s1c1
Sequence:CCGGCAGTGCAAACATAACAGCATTCTCGAGAATGCTGTTATGTTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-541s1c1
Sequence:CCGGCAGGAATTATCCTCTGAATTTCTCGAGAAATTCAGAGGATAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-406s1c1
Sequence:CCGGGCTGCCATTCATTATAGGAAACTCGAGTTTCCTATAATGAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-1097s1c1
Sequence:CCGGGCAAAGATTCTCTTCCCACAACTCGAGTTGTGGGAAGAGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-1140s1c1
Sequence:CCGGCCAGCAGGAATGTTGGAGAATCTCGAGATTCTCCAACATTCCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373039
TRIM75 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 75
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-648s1c1
Sequence:CCGGCAGTGCAAACATAACAGCATTCTCGAGAATGCTGTTATGTTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-541s1c1
Sequence:CCGGCAGGAATTATCCTCTGAATTTCTCGAGAAATTCAGAGGATAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-406s1c1
Sequence:CCGGGCTGCCATTCATTATAGGAAACTCGAGTTTCCTATAATGAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-1097s1c1
Sequence:CCGGGCAAAGATTCTCTTCCCACAACTCGAGTTGTGGGAAGAGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373039.1-1140s1c1
Sequence:CCGGCCAGCAGGAATGTTGGAGAATCTCGAGATTCTCCAACATTCCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105575
TRIM75 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 75
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-278s21c1
Sequence:CCGGAGACCACCTTGTGCGAGAAACCTCGAGGTTTCTCGCACAAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-642s21c1
Sequence:GTACCGGGAAACTCAGTGCAAACATAACCTCGAGGTTATGTTTGCACTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-1069s21c1
Sequence:CCGGGATAAGTCAGAATGGGCTATTCTCGAGAATAGCCCATTCTGACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-738s21c1
Sequence:CCGGGGAATTGCTGTCACAAATTAACTCGAGTTAATTTGTGACAGCAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-243s21c1
Sequence:CCGGCCAGAGCACCAAGAGTAATAACTCGAGTTATTACTCTTGGTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105575
TRIM75 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 75
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-278s21c1
Sequence:CCGGAGACCACCTTGTGCGAGAAACCTCGAGGTTTCTCGCACAAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-642s21c1
Sequence:GTACCGGGAAACTCAGTGCAAACATAACCTCGAGGTTATGTTTGCACTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-1069s21c1
Sequence:CCGGGATAAGTCAGAATGGGCTATTCTCGAGAATAGCCCATTCTGACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-738s21c1
Sequence:CCGGGGAATTGCTGTCACAAATTAACTCGAGTTAATTTGTGACAGCAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-243s21c1
Sequence:CCGGCCAGAGCACCAAGAGTAATAACTCGAGTTATTACTCTTGGTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105575
TRIM75 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 75
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-278s21c1
Sequence:CCGGAGACCACCTTGTGCGAGAAACCTCGAGGTTTCTCGCACAAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-642s21c1
Sequence:GTACCGGGAAACTCAGTGCAAACATAACCTCGAGGTTATGTTTGCACTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-1069s21c1
Sequence:CCGGGATAAGTCAGAATGGGCTATTCTCGAGAATAGCCCATTCTGACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-738s21c1
Sequence:CCGGGGAATTGCTGTCACAAATTAACTCGAGTTAATTTGTGACAGCAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105575.1-243s21c1
Sequence:CCGGCCAGAGCACCAAGAGTAATAACTCGAGTTATTACTCTTGGTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033429
TRIM75 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 75
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-831s21c1
Sequence:CCGGAGGGCTAATGAGCGCACTAAACTCGAGTTTAGTGCGCTCATTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033429.1-2202s21c1
Sequence:CCGGGGTCCAGCCCTCCCAATTATTCTCGAGAATAATTGGGAGGGCTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-1294s21c1
Sequence:CCGGGATAGAACCTGCGTAACATTTCTCGAGAAATGTTACGCAGGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-1684s21c1
Sequence:CCGGGGTCCTGTCTGCCCTTATTTCCTCGAGGAAATAAGGGCAGACAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-995s21c1
Sequence:CCGGAGAGACTGCTTGATAACATAGCTCGAGCTATGTTATCAAGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033429
TRIM75 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 75
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-831s21c1
Sequence:CCGGAGGGCTAATGAGCGCACTAAACTCGAGTTTAGTGCGCTCATTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033429.1-2202s21c1
Sequence:CCGGGGTCCAGCCCTCCCAATTATTCTCGAGAATAATTGGGAGGGCTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-1294s21c1
Sequence:CCGGGATAGAACCTGCGTAACATTTCTCGAGAAATGTTACGCAGGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-1684s21c1
Sequence:CCGGGGTCCTGTCTGCCCTTATTTCCTCGAGGAAATAAGGGCAGACAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-995s21c1
Sequence:CCGGAGAGACTGCTTGATAACATAGCTCGAGCTATGTTATCAAGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033429
TRIM75 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 75
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-831s21c1
Sequence:CCGGAGGGCTAATGAGCGCACTAAACTCGAGTTTAGTGCGCTCATTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033429.1-2202s21c1
Sequence:CCGGGGTCCAGCCCTCCCAATTATTCTCGAGAATAATTGGGAGGGCTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-1294s21c1
Sequence:CCGGGATAGAACCTGCGTAACATTTCTCGAGAAATGTTACGCAGGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-1684s21c1
Sequence:CCGGGGTCCTGTCTGCCCTTATTTCCTCGAGGAAATAAGGGCAGACAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033429.1-995s21c1
Sequence:CCGGAGAGACTGCTTGATAACATAGCTCGAGCTATGTTATCAAGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks