EMAIL THIS PAGE TO A FRIEND

TRIM77

tripartite motif containing 77

Synonyms: TRIM77P
Species: Human TRIM77(390231)
UniProtKB ID: I1YAP6
Gene ID:
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001717744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001717744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001717744 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717744 Rosetta Predictions human pricing
XM_936301 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419162 predicted 869
2 SASI_Hs02_00419163 predicted 1050
3 SASI_Hs02_00419164 predicted 959
4 SASI_Hs02_00419165 predicted 1031
5 SASI_Hs02_00419166 predicted 842
6 SASI_Hs02_00419167 predicted 666
7 SASI_Hs02_00419168 predicted 1085
8 SASI_Hs02_00419169 predicted 940
9 SASI_Hs02_00419170 predicted 1036
10 SASI_Hs02_00419171 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482013 predicted 864
2 SASI_Hs02_00482014 predicted 1049
3 SASI_Hs02_00482015 predicted 956
4 SASI_Hs02_00482016 predicted 1038
5 SASI_Hs02_00482017 predicted 839
6 SASI_Hs02_00482018 predicted 660
7 SASI_Hs02_00482019 predicted 1086
8 SASI_Hs02_00482020 predicted 934
9 SASI_Hs02_00482021 predicted 1038
10 SASI_Hs02_00482022 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001717744
TRIM77 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 77
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-866s21c1
Sequence:CCGGTCACCTTGGATCGTAAGATATCTCGAGATATCTTACGATCCAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-184s21c1
Sequence:CCGGATGTACTTCAAACGCATTATTCTCGAGAATAATGCGTTTGAAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-45s21c1
Sequence:CCGGCTCGATCTGCACAGACTATTTCTCGAGAAATAGTCTGTGCAGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-735s21c1
Sequence:CCGGTCAGGATTTGGGAGACGTAATCTCGAGATTACGTCTCCCAAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-1180s21c1
Sequence:CCGGCCACTGTTACCTCACTATATTCTCGAGAATATAGTGAGGTAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001717744
TRIM77 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 77
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-866s21c1
Sequence:CCGGTCACCTTGGATCGTAAGATATCTCGAGATATCTTACGATCCAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-184s21c1
Sequence:CCGGATGTACTTCAAACGCATTATTCTCGAGAATAATGCGTTTGAAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-45s21c1
Sequence:CCGGCTCGATCTGCACAGACTATTTCTCGAGAAATAGTCTGTGCAGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-735s21c1
Sequence:CCGGTCAGGATTTGGGAGACGTAATCTCGAGATTACGTCTCCCAAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-1180s21c1
Sequence:CCGGCCACTGTTACCTCACTATATTCTCGAGAATATAGTGAGGTAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001717744
TRIM77 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 77
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-866s21c1
Sequence:CCGGTCACCTTGGATCGTAAGATATCTCGAGATATCTTACGATCCAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-184s21c1
Sequence:CCGGATGTACTTCAAACGCATTATTCTCGAGAATAATGCGTTTGAAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-45s21c1
Sequence:CCGGCTCGATCTGCACAGACTATTTCTCGAGAAATAGTCTGTGCAGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-735s21c1
Sequence:CCGGTCAGGATTTGGGAGACGTAATCTCGAGATTACGTCTCCCAAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717744.1-1180s21c1
Sequence:CCGGCCACTGTTACCTCACTATATTCTCGAGAATATAGTGAGGTAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks