EMAIL THIS PAGE TO A FRIEND

TRIM7

tripartite motif containing 7

Synonyms: GNIP RNF90
Gene ID:
Human(81786) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Multiple transcript variants have been found for this gene, and some of them encode the same isoform. [provided by RefSeq, Jul 2008]
Mouse(94089) tripartite motif-containing 7
Rat(303089) tripartite motif-containing 7
naked mole-rat(101716760) tripartite motif containing 7
Domestic Rabbit(100351330) tripartite motif containing 7
domestic guinea pig(100719333) tripartite motif containing 7
cow(539804) tripartite motif containing 7
sheep(101106425) tripartite motif containing 7
chicken(417040) tripartite motif containing 7
dog(491670) tripartite motif containing 7
domestic cat(101083233) tripartite motif containing 7
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033342 Rosetta Predictions human pricing
NM_203293 Rosetta Predictions human pricing
NM_203294 Rosetta Predictions human pricing
NM_203295 Rosetta Predictions human pricing
NM_203296 Rosetta Predictions human pricing
NM_203297 Rosetta Predictions human pricing
XM_001070008 Rosetta Predictions rat pricing
XM_220359 Rosetta Predictions rat pricing
NM_053166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361193 predicted 455
2 SASI_Hs01_00199494 predicted 451
3 SASI_Hs01_00199495 predicted 360
4 SASI_Hs01_00199496 predicted 199
5 SASI_Hs01_00199497 predicted 458
6 SASI_Hs01_00199498 predicted 462
7 SASI_Hs01_00199499 predicted 206
8 SASI_Hs01_00199500 predicted 779
9 SASI_Hs01_00199501 predicted 582
10 SASI_Hs01_00199502 predicted 779
11 SASI_Hs01_00199503 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102957 predicted 1934
2 SASI_Hs01_00102959 predicted 1008
3 SASI_Hs01_00102961 predicted 965
4 SASI_Hs01_00102962 predicted 2069
5 SASI_Hs01_00102963 predicted 1478
6 SASI_Hs01_00102964 predicted 1291
7 SASI_Hs01_00102965 predicted 1493
8 SASI_Hs01_00102966 predicted 1715
9 SASI_Hs02_00373213 predicted 1986
10 SASI_Hs02_00373214 predicted 905
11 SASI_Hs01_00102958 predicted 904
12 SASI_Hs01_00102960 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146266 predicted 1660
2 SASI_Hs01_00146268 predicted 739
3 SASI_Hs01_00146270 predicted 689
4 SASI_Hs01_00146271 predicted 1797
5 SASI_Hs01_00146272 predicted 1205
6 SASI_Hs01_00146273 predicted 1016
7 SASI_Hs01_00146274 predicted 1220
8 SASI_Hs01_00146275 predicted 1437
9 SASI_Hs02_00373215 predicted 1720
10 SASI_Hs02_00373216 predicted 628
11 SASI_Hs01_00146267 predicted 634
12 SASI_Hs01_00146269 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184652 predicted 1731
2 SASI_Hs01_00184654 predicted 799
3 SASI_Hs01_00184656 predicted 756
4 SASI_Hs01_00184657 predicted 1865
5 SASI_Hs01_00184658 predicted 1277
6 SASI_Hs01_00184659 predicted 1086
7 SASI_Hs01_00184660 predicted 1296
8 SASI_Hs01_00184661 predicted 1510
9 SASI_Hs02_00373217 predicted 1782
10 SASI_Hs02_00373218 predicted 703
11 SASI_Hs01_00184653 predicted 698
12 SASI_Hs01_00184655 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020092 predicted 1942
2 SASI_Hs01_00020094 predicted 1010
3 SASI_Hs01_00020096 predicted 970
4 SASI_Hs01_00020097 predicted 2075
5 SASI_Hs01_00020098 predicted 1491
6 SASI_Hs01_00020099 predicted 1298
7 SASI_Hs01_00020100 predicted 1496
8 SASI_Hs01_00020101 predicted 1717
9 SASI_Hs02_00373219 predicted 1995
10 SASI_Hs02_00373220 predicted 912
11 SASI_Hs01_00020093 predicted 917
12 SASI_Hs01_00020095 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082858 predicted 2099
2 SASI_Hs01_00082860 predicted 1165
3 SASI_Hs01_00082862 predicted 1129
4 SASI_Hs01_00082863 predicted 2226
5 SASI_Hs01_00082864 predicted 1643
6 SASI_Hs01_00082865 predicted 1450
7 SASI_Hs01_00082866 predicted 1656
8 SASI_Hs01_00082867 predicted 1870
9 SASI_Hs02_00373221 predicted 2150
10 SASI_Hs02_00373222 predicted 1068
11 SASI_Hs01_00082859 predicted 1064
12 SASI_Hs01_00082861 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330073 predicted 1009
2 SASI_Rn02_00330074 predicted 1014
3 SASI_Rn02_00330075 predicted 1229
4 SASI_Rn02_00330076 predicted 536
5 SASI_Rn02_00330077 predicted 696
6 SASI_Rn02_00330078 predicted 1009
7 SASI_Rn02_00330079 predicted 1445
8 SASI_Rn02_00330080 predicted 651
9 SASI_Rn02_00330081 predicted 1318
10 SASI_Rn02_00330082 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379245 predicted 1001
2 SASI_Rn02_00379246 predicted 1015
3 SASI_Rn02_00379247 predicted 1224
4 SASI_Rn02_00379248 predicted 541
5 SASI_Rn02_00379249 predicted 703
6 SASI_Rn02_00379250 predicted 1014
7 SASI_Rn02_00379251 predicted 1442
8 SASI_Rn02_00379252 predicted 650
9 SASI_Rn02_00379253 predicted 1310
10 SASI_Rn02_00379254 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337704 predicted 973
2 SASI_Mm02_00337705 predicted 441
3 SASI_Mm02_00337706 predicted 778
4 SASI_Mm02_00337707 predicted 528
5 SASI_Mm02_00337708 predicted 560
6 SASI_Mm02_00337709 predicted 521
7 SASI_Mm02_00337710 predicted 850
8 SASI_Mm02_00337711 predicted 1081
9 SASI_Mm02_00337712 predicted 530
10 SASI_Mm02_00337713 predicted 679
11 SASI_Mm01_00048153 predicted 1285
12 SASI_Mm01_00048154 predicted 1291
13 SASI_Mm01_00048155 predicted 1261
14 SASI_Mm01_00048156 predicted 810
15 SASI_Mm01_00048157 predicted 983
16 SASI_Mm01_00048158 predicted 947
17 SASI_Mm01_00048159 predicted 824
18 SASI_Mm01_00048160 predicted 975
19 SASI_Mm01_00048161 predicted 683
20 SASI_Mm01_00048162 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053166
TRIM7 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-152s1c1
Sequence:CCGGTGCTCCATCTGCCTAGAGTTTCTCGAGAAACTCTAGGCAGATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053166.1-2059s1c1
Sequence:CCGGGCAGTTAGAATCTGAGTGTATCTCGAGATACACTCAGATTCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-463s1c1
Sequence:CCGGCGGAGAGCAACTTAAGCTCTACTCGAGTAGAGCTTAAGTTGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-773s1c1
Sequence:CCGGAGAGAGAGAATATGGTTGAAACTCGAGTTTCAACCATATTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-611s1c1
Sequence:CCGGGCCTTGAAGAAGGTACTGGAACTCGAGTTCCAGTACCTTCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-922s21c1
Sequence:CCGGGGGCAATGCAACTCAACAATGCTCGAGCATTGTTGAGTTGCATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-746s21c1
Sequence:CCGGTAACCATCCTCGCCGCTTTGACTCGAGTCAAAGCGGCGAGGATGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-568s21c1
Sequence:CCGGCCCTCAAGAGTTTCGTCTTAACTCGAGTTAAGACGAAACTCTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053166
TRIM7 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-152s1c1
Sequence:CCGGTGCTCCATCTGCCTAGAGTTTCTCGAGAAACTCTAGGCAGATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053166.1-2059s1c1
Sequence:CCGGGCAGTTAGAATCTGAGTGTATCTCGAGATACACTCAGATTCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-463s1c1
Sequence:CCGGCGGAGAGCAACTTAAGCTCTACTCGAGTAGAGCTTAAGTTGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-773s1c1
Sequence:CCGGAGAGAGAGAATATGGTTGAAACTCGAGTTTCAACCATATTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-611s1c1
Sequence:CCGGGCCTTGAAGAAGGTACTGGAACTCGAGTTCCAGTACCTTCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-922s21c1
Sequence:CCGGGGGCAATGCAACTCAACAATGCTCGAGCATTGTTGAGTTGCATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-746s21c1
Sequence:CCGGTAACCATCCTCGCCGCTTTGACTCGAGTCAAAGCGGCGAGGATGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-568s21c1
Sequence:CCGGCCCTCAAGAGTTTCGTCTTAACTCGAGTTAAGACGAAACTCTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053166
TRIM7 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-152s1c1
Sequence:CCGGTGCTCCATCTGCCTAGAGTTTCTCGAGAAACTCTAGGCAGATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053166.1-2059s1c1
Sequence:CCGGGCAGTTAGAATCTGAGTGTATCTCGAGATACACTCAGATTCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-463s1c1
Sequence:CCGGCGGAGAGCAACTTAAGCTCTACTCGAGTAGAGCTTAAGTTGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-773s1c1
Sequence:CCGGAGAGAGAGAATATGGTTGAAACTCGAGTTTCAACCATATTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053166.1-611s1c1
Sequence:CCGGGCCTTGAAGAAGGTACTGGAACTCGAGTTCCAGTACCTTCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-922s21c1
Sequence:CCGGGGGCAATGCAACTCAACAATGCTCGAGCATTGTTGAGTTGCATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-746s21c1
Sequence:CCGGTAACCATCCTCGCCGCTTTGACTCGAGTCAAAGCGGCGAGGATGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053166.2-568s21c1
Sequence:CCGGCCCTCAAGAGTTTCGTCTTAACTCGAGTTAAGACGAAACTCTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033342
VALIDATED
TRIM7 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033973    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_033342.1-745s1c1
Sequence:CCGGCTGGAGGACTGTGAGGTGTTCCTCGAGGAACACCTCACAGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033970    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-827s1c1
Sequence:CCGGCGTGGGACATTACAGAGGCCTCTCGAGAGGCCTCTGTAATGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033972    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_033342.1-752s1c1
Sequence:CCGGACTGTGAGGTGTTCCGGTCCACTCGAGTGGACCGGAACACCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033971    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-828s1c1
Sequence:CCGGGTGGGACATTACAGAGGCCTGCTCGAGCAGGCCTCTGTAATGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033969    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-917s1c1
Sequence:CCGGCAGAAAGATAATAGAGTCCATCTCGAGATGGACTCTATTATCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-825s21c1
Sequence:CCGGATATAGGGTGTCCACATAATTCTCGAGAATTATGTGGACACCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033342.2-604s21c1
Sequence:CCGGCAGGCTGAGGGTCTTGAAGAACTCGAGTTCTTCAAGACCCTCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-468s21c1
Sequence:CCGGGCGAACCCTTCAAGCTCTACTCTCGAGAGTAGAGCTTGAAGGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033342.2-629s21c1
Sequence:CCGGCTGGAGGACTGTGAGGTGTTCCTCGAGGAACACCTCACAGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-156s21c1
Sequence:CCGGCCATCTGCCTAGAGCTCTTTCCTCGAGGAAAGAGCTCTAGGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033342
VALIDATED
TRIM7 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033973    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_033342.1-745s1c1
Sequence:CCGGCTGGAGGACTGTGAGGTGTTCCTCGAGGAACACCTCACAGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033970    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-827s1c1
Sequence:CCGGCGTGGGACATTACAGAGGCCTCTCGAGAGGCCTCTGTAATGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033972    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_033342.1-752s1c1
Sequence:CCGGACTGTGAGGTGTTCCGGTCCACTCGAGTGGACCGGAACACCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033971    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-828s1c1
Sequence:CCGGGTGGGACATTACAGAGGCCTGCTCGAGCAGGCCTCTGTAATGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033969    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-917s1c1
Sequence:CCGGCAGAAAGATAATAGAGTCCATCTCGAGATGGACTCTATTATCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-825s21c1
Sequence:CCGGATATAGGGTGTCCACATAATTCTCGAGAATTATGTGGACACCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033342.2-604s21c1
Sequence:CCGGCAGGCTGAGGGTCTTGAAGAACTCGAGTTCTTCAAGACCCTCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-468s21c1
Sequence:CCGGGCGAACCCTTCAAGCTCTACTCTCGAGAGTAGAGCTTGAAGGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033342.2-629s21c1
Sequence:CCGGCTGGAGGACTGTGAGGTGTTCCTCGAGGAACACCTCACAGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-156s21c1
Sequence:CCGGCCATCTGCCTAGAGCTCTTTCCTCGAGGAAAGAGCTCTAGGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033342
VALIDATED
TRIM7 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033973    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_033342.1-745s1c1
Sequence:CCGGCTGGAGGACTGTGAGGTGTTCCTCGAGGAACACCTCACAGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033970    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-827s1c1
Sequence:CCGGCGTGGGACATTACAGAGGCCTCTCGAGAGGCCTCTGTAATGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033972    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_033342.1-752s1c1
Sequence:CCGGACTGTGAGGTGTTCCGGTCCACTCGAGTGGACCGGAACACCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033971    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-828s1c1
Sequence:CCGGGTGGGACATTACAGAGGCCTGCTCGAGCAGGCCTCTGTAATGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033969    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033342.1-917s1c1
Sequence:CCGGCAGAAAGATAATAGAGTCCATCTCGAGATGGACTCTATTATCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-825s21c1
Sequence:CCGGATATAGGGTGTCCACATAATTCTCGAGAATTATGTGGACACCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033342.2-604s21c1
Sequence:CCGGCAGGCTGAGGGTCTTGAAGAACTCGAGTTCTTCAAGACCCTCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-468s21c1
Sequence:CCGGGCGAACCCTTCAAGCTCTACTCTCGAGAGTAGAGCTTGAAGGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033342.2-629s21c1
Sequence:CCGGCTGGAGGACTGTGAGGTGTTCCTCGAGGAACACCTCACAGTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033342.2-156s21c1
Sequence:CCGGCCATCTGCCTAGAGCTCTTTCCTCGAGGAAAGAGCTCTAGGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks