EMAIL THIS PAGE TO A FRIEND

TRIM8

tripartite motif containing 8

Synonyms: GERP RNF27
UniProtKB ID: Q9BZR9, A6NI31, Q9C028
Gene ID:
Human(81603) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to nuclear bodies. Its structure is similar to some tumor suppressor proteins and its gene maps to a locus thought to contain tumor suppressor genes. [provided by RefSeq, Jul 2008]
Mouse(93679) tripartite motif-containing 8
Rat(688785) tripartite motif-containing 8
Zebrafish(559967) tripartite motif-containing 8
chicken(423864) tripartite motif containing 8
dog(486863) tripartite motif containing 8
Horse(100147211) tripartite motif containing 8
domestic cat(101082095) tripartite motif containing 8
cow(782444) tripartite motif containing 8
sheep(101115246) tripartite motif containing 8
domestic guinea pig(100723947) tripartite motif containing 8
naked mole-rat(101725778) tripartite motif containing 8
Domestic Rabbit(100345616) tripartite motif containing 8
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030912 Rosetta Predictions human pricing
NM_001128083 Rosetta Predictions rat pricing
NM_053100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238295 predicted 1523
2 SASI_Hs01_00238296 predicted 767
3 SASI_Hs01_00238297 predicted 669
4 SASI_Hs01_00238298 predicted 1251
5 SASI_Hs02_00358448 predicted 281
6 SASI_Hs01_00238299 predicted 804
7 SASI_Hs01_00238303 predicted 1016
8 SASI_Hs01_00238304 predicted 676
9 SASI_Hs02_00358449 predicted 893
10 SASI_Hs02_00358450 predicted 1521
11 SASI_Hs01_00238300 predicted 1394
12 SASI_Hs01_00238301 predicted 1383
13 SASI_Hs01_00238302 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254950 predicted 1991
2 SASI_Rn02_00254951 predicted 1559
3 SASI_Rn02_00254952 predicted 2390
4 SASI_Rn02_00254953 predicted 1781
5 SASI_Rn02_00254954 predicted 2496
6 SASI_Rn02_00254955 predicted 1498
7 SASI_Rn02_00254956 predicted 1175
8 SASI_Rn02_00254957 predicted 1538
9 SASI_Rn02_00254958 predicted 1673
10 SASI_Rn02_00254959 predicted 1642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196157 predicted 1772
2 SASI_Mm01_00196158 predicted 1341
3 SASI_Mm01_00196160 predicted 1285
4 SASI_Mm02_00337602 predicted 1568
5 SASI_Mm01_00196161 predicted 958
6 SASI_Mm01_00196162 predicted 1317
7 SASI_Mm01_00196163 predicted 936
8 SASI_Mm01_00196164 predicted 2177
9 SASI_Mm01_00196165 predicted 2172
10 SASI_Mm02_00337603 predicted 951
11 SASI_Mm01_00196159 predicted 897
12 SASI_Mm01_00196166 predicted 1742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030912
VALIDATED
TRIM8 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-615s21c1
Sequence:CCGGCCAGTACTGCTGCTACTACAGCTCGAGCTGTAGTAGCAGCAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030912.2-2254s21c1
Sequence:CCGGACCTTTAGATTGTGCGACTTTCTCGAGAAAGTCGCACAATCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-282s21c1
Sequence:CCGGAGAGTGCAACCAGGCCTACAACTCGAGTTGTAGGCCTGGTTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-1508s21c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-1724s21c1
Sequence:CCGGAGGATTTCTACAGGGTGTATGCTCGAGCATACACCCTGTAGAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-341s21c1
Sequence:CCGGACATCGTGGAGAAGTTCAATGCTCGAGCATTGAACTTCTCCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-743s21c1
Sequence:CCGGTTGAGGACCAGCTGTACAAACCTCGAGGTTTGTACAGCTGGTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030912.2-2228s21c1
Sequence:CCGGTTTGATCACTGATCGAGTAAGCTCGAGCTTACTCGATCAGTGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-1394s1c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030912.1-90s1c1
Sequence:CCGGGCTGCCGTGCAAACACAACTTCTCGAGAAGTTGTGTTTGCACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-561s1c1
Sequence:CCGGCCGAAGGAATGAAATCCGGAACTCGAGTTCCGGATTTCATTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-874s1c1
Sequence:CCGGCTCTTTGATAAGACGGAGGATCTCGAGATCCTCCGTCTTATCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-1632s1c1
Sequence:CCGGGCAGCCGTCCACCAAACACTACTCGAGTAGTGTTTGGTGGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030912
VALIDATED
TRIM8 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-615s21c1
Sequence:CCGGCCAGTACTGCTGCTACTACAGCTCGAGCTGTAGTAGCAGCAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030912.2-2254s21c1
Sequence:CCGGACCTTTAGATTGTGCGACTTTCTCGAGAAAGTCGCACAATCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-282s21c1
Sequence:CCGGAGAGTGCAACCAGGCCTACAACTCGAGTTGTAGGCCTGGTTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-1508s21c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-1724s21c1
Sequence:CCGGAGGATTTCTACAGGGTGTATGCTCGAGCATACACCCTGTAGAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-341s21c1
Sequence:CCGGACATCGTGGAGAAGTTCAATGCTCGAGCATTGAACTTCTCCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-743s21c1
Sequence:CCGGTTGAGGACCAGCTGTACAAACCTCGAGGTTTGTACAGCTGGTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030912.2-2228s21c1
Sequence:CCGGTTTGATCACTGATCGAGTAAGCTCGAGCTTACTCGATCAGTGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-1394s1c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030912.1-90s1c1
Sequence:CCGGGCTGCCGTGCAAACACAACTTCTCGAGAAGTTGTGTTTGCACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-561s1c1
Sequence:CCGGCCGAAGGAATGAAATCCGGAACTCGAGTTCCGGATTTCATTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-874s1c1
Sequence:CCGGCTCTTTGATAAGACGGAGGATCTCGAGATCCTCCGTCTTATCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-1632s1c1
Sequence:CCGGGCAGCCGTCCACCAAACACTACTCGAGTAGTGTTTGGTGGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030912
VALIDATED
TRIM8 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-615s21c1
Sequence:CCGGCCAGTACTGCTGCTACTACAGCTCGAGCTGTAGTAGCAGCAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030912.2-2254s21c1
Sequence:CCGGACCTTTAGATTGTGCGACTTTCTCGAGAAAGTCGCACAATCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-282s21c1
Sequence:CCGGAGAGTGCAACCAGGCCTACAACTCGAGTTGTAGGCCTGGTTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-1508s21c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-1724s21c1
Sequence:CCGGAGGATTTCTACAGGGTGTATGCTCGAGCATACACCCTGTAGAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-341s21c1
Sequence:CCGGACATCGTGGAGAAGTTCAATGCTCGAGCATTGAACTTCTCCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030912.2-743s21c1
Sequence:CCGGTTGAGGACCAGCTGTACAAACCTCGAGGTTTGTACAGCTGGTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030912.2-2228s21c1
Sequence:CCGGTTTGATCACTGATCGAGTAAGCTCGAGCTTACTCGATCAGTGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-1394s1c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030912.1-90s1c1
Sequence:CCGGGCTGCCGTGCAAACACAACTTCTCGAGAAGTTGTGTTTGCACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-561s1c1
Sequence:CCGGCCGAAGGAATGAAATCCGGAACTCGAGTTCCGGATTTCATTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-874s1c1
Sequence:CCGGCTCTTTGATAAGACGGAGGATCTCGAGATCCTCCGTCTTATCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030912.1-1632s1c1
Sequence:CCGGGCAGCCGTCCACCAAACACTACTCGAGTAGTGTTTGGTGGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053100
VALIDATED
TRIM8 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2706s21c1
Sequence:CCGGGGAGTTGGGACAGTATCTTAACTCGAGTTAAGATACTGTCCCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2181s21c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2421s21c1
Sequence:CCGGAGCCGTCCACCAAACACTATGCTCGAGCATAGTGTTTGGTGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-958s21c1
Sequence:CCGGGTGCAACCAGGCCTACAATCACTCGAGTGATTGTAGGCCTGGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-1288s21c1
Sequence:CCGGCCAGTACTGCTGCTACTACAGCTCGAGCTGTAGTAGCAGCAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-1744s1c1
Sequence:CCGGCCAGGATTTCTACAGGGTGTACTCGAGTACACCCTGTAGAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-226s1c1
Sequence:CCGGGCTGCCATGCAAACATAACTTCTCGAGAAGTTATGTTTGCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-1643s1c1
Sequence:CCGGCAGGAGTATTCACACCCACTTCTCGAGAAGTGGGTGTGAATACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053100.1-1172s1c1
Sequence:CCGGCAGTTGCGGAAGATGCTAGAACTCGAGTTCTAGCATCTTCCGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-700s1c1
Sequence:CCGGGAGGAATGAGATACGGAAGATCTCGAGATCTTCCGTATCTCATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053100
VALIDATED
TRIM8 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2706s21c1
Sequence:CCGGGGAGTTGGGACAGTATCTTAACTCGAGTTAAGATACTGTCCCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2181s21c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2421s21c1
Sequence:CCGGAGCCGTCCACCAAACACTATGCTCGAGCATAGTGTTTGGTGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-958s21c1
Sequence:CCGGGTGCAACCAGGCCTACAATCACTCGAGTGATTGTAGGCCTGGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-1288s21c1
Sequence:CCGGCCAGTACTGCTGCTACTACAGCTCGAGCTGTAGTAGCAGCAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-1744s1c1
Sequence:CCGGCCAGGATTTCTACAGGGTGTACTCGAGTACACCCTGTAGAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-226s1c1
Sequence:CCGGGCTGCCATGCAAACATAACTTCTCGAGAAGTTATGTTTGCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-1643s1c1
Sequence:CCGGCAGGAGTATTCACACCCACTTCTCGAGAAGTGGGTGTGAATACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053100.1-1172s1c1
Sequence:CCGGCAGTTGCGGAAGATGCTAGAACTCGAGTTCTAGCATCTTCCGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-700s1c1
Sequence:CCGGGAGGAATGAGATACGGAAGATCTCGAGATCTTCCGTATCTCATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053100
VALIDATED
TRIM8 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2706s21c1
Sequence:CCGGGGAGTTGGGACAGTATCTTAACTCGAGTTAAGATACTGTCCCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2181s21c1
Sequence:CCGGGCCGCAAGATTCTCGTCTGTTCTCGAGAACAGACGAGAATCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-2421s21c1
Sequence:CCGGAGCCGTCCACCAAACACTATGCTCGAGCATAGTGTTTGGTGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-958s21c1
Sequence:CCGGGTGCAACCAGGCCTACAATCACTCGAGTGATTGTAGGCCTGGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053100.2-1288s21c1
Sequence:CCGGCCAGTACTGCTGCTACTACAGCTCGAGCTGTAGTAGCAGCAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-1744s1c1
Sequence:CCGGCCAGGATTTCTACAGGGTGTACTCGAGTACACCCTGTAGAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-226s1c1
Sequence:CCGGGCTGCCATGCAAACATAACTTCTCGAGAAGTTATGTTTGCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-1643s1c1
Sequence:CCGGCAGGAGTATTCACACCCACTTCTCGAGAAGTGGGTGTGAATACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053100.1-1172s1c1
Sequence:CCGGCAGTTGCGGAAGATGCTAGAACTCGAGTTCTAGCATCTTCCGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053100.1-700s1c1
Sequence:CCGGGAGGAATGAGATACGGAAGATCTCGAGATCTTCCGTATCTCATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks