EMAIL THIS PAGE TO A FRIEND

TRIM9

tripartite motif containing 9

Synonyms: RNF91 SPRING
Gene ID:
Human(114088) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(94090) tripartite motif-containing 9
Rat(155812) tripartite motif-containing 9
fruit fly(34453) CG31721 gene product from transcript CG31721-RB
domestic cat(101089618) tripartite motif containing 9
dog(490687) tripartite motif containing 9
chicken(423579) tripartite motif containing 9
Zebrafish(336099) tripartite motif-containing 9
naked mole-rat(101721984) tripartite motif containing 9
domestic guinea pig(100729922) tripartite motif containing 9
cow(767615) tripartite motif containing 9
sheep(101105756) tripartite motif containing 9
272 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015163 Rosetta Predictions human pricing
NM_052978 Rosetta Predictions human pricing
NM_130420 Rosetta Predictions rat pricing
NM_001110202 Rosetta Predictions mouse pricing
NM_001110203 Rosetta Predictions mouse pricing
NM_053167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220742 predicted 1239
2 SASI_Hs01_00220743 predicted 1277
3 SASI_Hs01_00220744 predicted 1561
4 SASI_Hs01_00220745 predicted 1135
5 SASI_Hs02_00347142 predicted 1712
6 SASI_Hs01_00220746 predicted 1456
7 SASI_Hs01_00220747 predicted 910
8 SASI_Hs02_00347143 predicted 1666
9 SASI_Hs01_00220748 predicted 1621
10 SASI_Hs01_00220749 predicted 1611
11 SASI_Hs01_00220750 predicted 939
12 SASI_Hs01_00220751 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072995 predicted 1237
2 SASI_Hs01_00072996 predicted 1285
3 SASI_Hs01_00072997 predicted 1559
4 SASI_Hs01_00072998 predicted 1135
5 SASI_Hs02_00361788 predicted 1714
6 SASI_Hs01_00072999 predicted 1460
7 SASI_Hs01_00073000 predicted 910
8 SASI_Hs02_00361789 predicted 1674
9 SASI_Hs01_00073001 predicted 1621
10 SASI_Hs01_00073002 predicted 1604
11 SASI_Hs01_00073003 predicted 946
12 SASI_Hs01_00073004 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089572 predicted 2000
2 SASI_Rn01_00089573 predicted 2116
3 SASI_Rn01_00089574 predicted 977
4 SASI_Rn01_00089575 predicted 1684
5 SASI_Rn01_00089576 predicted 707
6 SASI_Rn01_00089577 predicted 990
7 SASI_Rn01_00089578 predicted 1505
8 SASI_Rn01_00089579 predicted 953
9 SASI_Rn01_00089580 predicted 358
10 SASI_Rn02_00267419 predicted 2217
11 SASI_Rn01_00089571 predicted 2109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304896 predicted 1192
2 SASI_Mm02_00304897 predicted 1592
3 SASI_Mm02_00304898 predicted 1211
4 SASI_Mm02_00304899 predicted 1454
5 SASI_Mm02_00304900 predicted 1789
6 SASI_Mm02_00304901 predicted 1244
7 SASI_Mm02_00304902 predicted 1204
8 SASI_Mm02_00304903 predicted 1661
9 SASI_Mm02_00304904 predicted 1280
10 SASI_Mm02_00304905 predicted 1657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304906 predicted 1193
2 SASI_Mm02_00304907 predicted 1596
3 SASI_Mm02_00304908 predicted 1211
4 SASI_Mm02_00304909 predicted 1446
5 SASI_Mm02_00304910 predicted 1789
6 SASI_Mm02_00304911 predicted 1239
7 SASI_Mm02_00304912 predicted 1212
8 SASI_Mm02_00304913 predicted 1660
9 SASI_Mm02_00304914 predicted 1279
10 SASI_Mm02_00304915 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337714 predicted 1195
2 SASI_Mm01_00070604 predicted 1595
3 SASI_Mm02_00337715 predicted 1215
4 SASI_Mm02_00337716 predicted 1447
5 SASI_Mm01_00070610 predicted 1786
6 SASI_Mm02_00337717 predicted 1246
7 SASI_Mm02_00337718 predicted 1206
8 SASI_Mm02_00337719 predicted 1665
9 SASI_Mm02_00337720 predicted 1281
10 SASI_Mm02_00337721 predicted 1658
11 SASI_Mm01_00070603 predicted 1947
12 SASI_Mm01_00070605 predicted 209
13 SASI_Mm01_00070606 predicted 2298
14 SASI_Mm01_00070607 predicted 2288
15 SASI_Mm01_00070608 predicted 2412
16 SASI_Mm01_00070609 predicted 1694
17 SASI_Mm01_00070611 predicted 1611
18 SASI_Mm01_00070612 predicted 1679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053167
TRIM9 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-2401s1c1
Sequence:CCGGCGACTTAAACAGAAAGACATTCTCGAGAATGTCTTTCTGTTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1945s1c1
Sequence:CCGGGCTGAGTTTGCATTCTTCTTTCTCGAGAAAGAAGAATGCAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-2246s1c1
Sequence:CCGGCGCATCGATGTGATGAAGGATCTCGAGATCCTTCATCACATCGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1169s1c1
Sequence:CCGGCGGGTCAACAAGGAGCATGAACTCGAGTTCATGCTCCTTGTTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1621s1c1
Sequence:CCGGCCGGGAAGTGTATGTTGGAAACTCGAGTTTCCAACATACACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053167
TRIM9 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-2401s1c1
Sequence:CCGGCGACTTAAACAGAAAGACATTCTCGAGAATGTCTTTCTGTTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1945s1c1
Sequence:CCGGGCTGAGTTTGCATTCTTCTTTCTCGAGAAAGAAGAATGCAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-2246s1c1
Sequence:CCGGCGCATCGATGTGATGAAGGATCTCGAGATCCTTCATCACATCGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1169s1c1
Sequence:CCGGCGGGTCAACAAGGAGCATGAACTCGAGTTCATGCTCCTTGTTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1621s1c1
Sequence:CCGGCCGGGAAGTGTATGTTGGAAACTCGAGTTTCCAACATACACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053167
TRIM9 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-2401s1c1
Sequence:CCGGCGACTTAAACAGAAAGACATTCTCGAGAATGTCTTTCTGTTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1945s1c1
Sequence:CCGGGCTGAGTTTGCATTCTTCTTTCTCGAGAAAGAAGAATGCAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-2246s1c1
Sequence:CCGGCGCATCGATGTGATGAAGGATCTCGAGATCCTTCATCACATCGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1169s1c1
Sequence:CCGGCGGGTCAACAAGGAGCATGAACTCGAGTTCATGCTCCTTGTTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053167.1-1621s1c1
Sequence:CCGGCCGGGAAGTGTATGTTGGAAACTCGAGTTTCCAACATACACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015163
TRIM9 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-582s1c1
Sequence:CCGGCCTGGACAAGATGAGCCTATACTCGAGTATAGGCTCATCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2029s1c1
Sequence:CCGGTCGGACATCATCCTCTCCAATCTCGAGATTGGAGAGGATGATGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2226s1c1
Sequence:CCGGCGACAAAGCTTGGGCAATGTACTCGAGTACATTGCCCAAGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2379s1c1
Sequence:CCGGCGATGAACAACAAGGTCCCATCTCGAGATGGGACCTTGTTGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-1362s1c1
Sequence:CCGGCGATGCCCTCAACAGAAGAAACTCGAGTTTCTTCTGTTGAGGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-932s21c1
Sequence:CCGGGGGTCTCCGACTATGACTATCCTCGAGGATAGTCATAGTCGGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-1916s21c1
Sequence:CCGGAGATTTCTGACGCCCTCATAACTCGAGTTATGAGGGCGTCAGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-2205s21c1
Sequence:CCGGTGATGGCAACGGTGGTCAATTCTCGAGAATTGACCACCGTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-2709s21c1
Sequence:CCGGGGTCCTCCTCGACTTAAATAGCTCGAGCTATTTAAGTCGAGGAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015163
TRIM9 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-582s1c1
Sequence:CCGGCCTGGACAAGATGAGCCTATACTCGAGTATAGGCTCATCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2029s1c1
Sequence:CCGGTCGGACATCATCCTCTCCAATCTCGAGATTGGAGAGGATGATGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2226s1c1
Sequence:CCGGCGACAAAGCTTGGGCAATGTACTCGAGTACATTGCCCAAGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2379s1c1
Sequence:CCGGCGATGAACAACAAGGTCCCATCTCGAGATGGGACCTTGTTGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-1362s1c1
Sequence:CCGGCGATGCCCTCAACAGAAGAAACTCGAGTTTCTTCTGTTGAGGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-932s21c1
Sequence:CCGGGGGTCTCCGACTATGACTATCCTCGAGGATAGTCATAGTCGGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-1916s21c1
Sequence:CCGGAGATTTCTGACGCCCTCATAACTCGAGTTATGAGGGCGTCAGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-2205s21c1
Sequence:CCGGTGATGGCAACGGTGGTCAATTCTCGAGAATTGACCACCGTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-2709s21c1
Sequence:CCGGGGTCCTCCTCGACTTAAATAGCTCGAGCTATTTAAGTCGAGGAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015163
TRIM9 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-582s1c1
Sequence:CCGGCCTGGACAAGATGAGCCTATACTCGAGTATAGGCTCATCTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2029s1c1
Sequence:CCGGTCGGACATCATCCTCTCCAATCTCGAGATTGGAGAGGATGATGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2226s1c1
Sequence:CCGGCGACAAAGCTTGGGCAATGTACTCGAGTACATTGCCCAAGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-2379s1c1
Sequence:CCGGCGATGAACAACAAGGTCCCATCTCGAGATGGGACCTTGTTGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015163.4-1362s1c1
Sequence:CCGGCGATGCCCTCAACAGAAGAAACTCGAGTTTCTTCTGTTGAGGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-932s21c1
Sequence:CCGGGGGTCTCCGACTATGACTATCCTCGAGGATAGTCATAGTCGGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-1916s21c1
Sequence:CCGGAGATTTCTGACGCCCTCATAACTCGAGTTATGAGGGCGTCAGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-2205s21c1
Sequence:CCGGTGATGGCAACGGTGGTCAATTCTCGAGAATTGACCACCGTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015163.5-2709s21c1
Sequence:CCGGGGTCCTCCTCGACTTAAATAGCTCGAGCTATTTAAGTCGAGGAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks