EMAIL THIS PAGE TO A FRIEND

TRIML1

tripartite motif family-like 1

Synonyms: RNF209
UniProtKB ID: Q8N9V2, Q96BE5
Gene ID:
Mouse(244448) tripartite motif family-like 1
Rat(290767) tripartite motif family-like 1
cow(520202) tripartite motif family-like 1
sheep(101117391) tripartite motif family-like 1
domestic guinea pig(100713833) tripartite motif family-like 1
naked mole-rat(101722679) tripartite motif family-like 1
Domestic Rabbit(100358847) tripartite motif family-like 1
chicken(430540) tripartite motif family-like 1
domestic cat(101098049) tripartite motif family-like 1
Horse(100050447) tripartite motif family-like 1
dog(475619) tripartite motif family-like 1
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178556 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178556 Rosetta Predictions human pricing
XM_001063622 Rosetta Predictions rat pricing
XM_224885 Rosetta Predictions rat pricing
NM_177742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044605 predicted 992
2 SASI_Hs01_00044606 predicted 627
3 SASI_Hs01_00044607 predicted 528
4 SASI_Hs01_00044608 predicted 260
5 SASI_Hs01_00044609 predicted 251
6 SASI_Hs01_00044610 predicted 1002
7 SASI_Hs01_00044611 predicted 827
8 SASI_Hs01_00044612 predicted 1352
9 SASI_Hs01_00044613 predicted 642
10 SASI_Hs02_00369803 predicted 1344
11 SASI_Hs01_00044604 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307837 predicted 1230
2 SASI_Rn02_00307838 predicted 1038
3 SASI_Rn02_00307839 predicted 828
4 SASI_Rn02_00307840 predicted 781
5 SASI_Rn02_00307841 predicted 430
6 SASI_Rn02_00307842 predicted 524
7 SASI_Rn02_00307843 predicted 555
8 SASI_Rn02_00307844 predicted 419
9 SASI_Rn02_00307845 predicted 223
10 SASI_Rn02_00307846 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382350 predicted 1229
2 SASI_Rn02_00382351 predicted 1040
3 SASI_Rn02_00382352 predicted 830
4 SASI_Rn02_00382353 predicted 786
5 SASI_Rn02_00382354 predicted 433
6 SASI_Rn02_00382355 predicted 525
7 SASI_Rn02_00382356 predicted 554
8 SASI_Rn02_00382357 predicted 416
9 SASI_Rn02_00382358 predicted 221
10 SASI_Rn02_00382359 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127422 predicted 816
2 SASI_Mm01_00127423 predicted 1069
3 SASI_Mm01_00127424 predicted 1345
4 SASI_Mm01_00127425 predicted 864
5 SASI_Mm01_00127426 predicted 409
6 SASI_Mm01_00127428 predicted 596
7 SASI_Mm02_00348113 predicted 528
8 SASI_Mm01_00127429 predicted 620
9 SASI_Mm01_00127430 predicted 1232
10 SASI_Mm02_00348114 predicted 627
11 SASI_Mm01_00127427 predicted 535
12 SASI_Mm01_00127431 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178556
TRIML1 MISSION shRNA Bacterial Glycerol Stock
tripartite motif family-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-568s21c1
Sequence:CCGGGGAAGCTCAGGCTGTACTAACCTCGAGGTTAGTACAGCCTGAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-823s21c1
Sequence:CCGGTCAAAGCTCGGCTTTCGAATCCTCGAGGATTCGAAAGCCGAGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-640s21c1
Sequence:CCGGACAGGTTGTTGTGTCAGAATACTCGAGTATTCTGACACAACAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-1240s21c1
Sequence:CCGGGTTCTCACTAATAGGTTTAAACTCGAGTTTAAACCTATTAGTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-615s1c1
Sequence:CCGGGCCAGGAAGAAACAAAGACTTCTCGAGAAGTCTTTGTTTCTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-155s1c1
Sequence:CCGGCTCACCTGTTTCATCTGCTTACTCGAGTAAGCAGATGAAACAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-248s1c1
Sequence:CCGGGAGGAACATAACACACCTTTACTCGAGTAAAGGTGTGTTATGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-1347s1c1
Sequence:CCGGTGGACTATGAATCTGGACATACTCGAGTATGTCCAGATTCATAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-771s1c1
Sequence:CCGGCCCAGCAAATCAGAAGCCTAACTCGAGTTAGGCTTCTGATTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178556
TRIML1 MISSION shRNA shRNA Plasmid DNA
tripartite motif family-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-568s21c1
Sequence:CCGGGGAAGCTCAGGCTGTACTAACCTCGAGGTTAGTACAGCCTGAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-823s21c1
Sequence:CCGGTCAAAGCTCGGCTTTCGAATCCTCGAGGATTCGAAAGCCGAGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-640s21c1
Sequence:CCGGACAGGTTGTTGTGTCAGAATACTCGAGTATTCTGACACAACAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-1240s21c1
Sequence:CCGGGTTCTCACTAATAGGTTTAAACTCGAGTTTAAACCTATTAGTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-615s1c1
Sequence:CCGGGCCAGGAAGAAACAAAGACTTCTCGAGAAGTCTTTGTTTCTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-155s1c1
Sequence:CCGGCTCACCTGTTTCATCTGCTTACTCGAGTAAGCAGATGAAACAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-248s1c1
Sequence:CCGGGAGGAACATAACACACCTTTACTCGAGTAAAGGTGTGTTATGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-1347s1c1
Sequence:CCGGTGGACTATGAATCTGGACATACTCGAGTATGTCCAGATTCATAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-771s1c1
Sequence:CCGGCCCAGCAAATCAGAAGCCTAACTCGAGTTAGGCTTCTGATTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178556
TRIML1 MISSION shRNA Lentiviral Transduction Particles
tripartite motif family-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-568s21c1
Sequence:CCGGGGAAGCTCAGGCTGTACTAACCTCGAGGTTAGTACAGCCTGAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-823s21c1
Sequence:CCGGTCAAAGCTCGGCTTTCGAATCCTCGAGGATTCGAAAGCCGAGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-640s21c1
Sequence:CCGGACAGGTTGTTGTGTCAGAATACTCGAGTATTCTGACACAACAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178556.3-1240s21c1
Sequence:CCGGGTTCTCACTAATAGGTTTAAACTCGAGTTTAAACCTATTAGTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-615s1c1
Sequence:CCGGGCCAGGAAGAAACAAAGACTTCTCGAGAAGTCTTTGTTTCTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-155s1c1
Sequence:CCGGCTCACCTGTTTCATCTGCTTACTCGAGTAAGCAGATGAAACAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-248s1c1
Sequence:CCGGGAGGAACATAACACACCTTTACTCGAGTAAAGGTGTGTTATGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-1347s1c1
Sequence:CCGGTGGACTATGAATCTGGACATACTCGAGTATGTCCAGATTCATAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178556.3-771s1c1
Sequence:CCGGCCCAGCAAATCAGAAGCCTAACTCGAGTTAGGCTTCTGATTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177742
TRIML1 MISSION shRNA Bacterial Glycerol Stock
tripartite motif family-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-1323s1c1
Sequence:CCGGCGTGCATAAAGTTGGTGTGTTCTCGAGAACACACCAACTTTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-153s1c1
Sequence:CCGGGCTGACCTGTTTCATCTGCTTCTCGAGAAGCAGATGAAACAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-588s1c1
Sequence:CCGGCCATGAGAAGGAACGAGTGATCTCGAGATCACTCGTTCCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-1187s1c1
Sequence:CCGGGCAAGGACTCTGTGAACAGAACTCGAGTTCTGTTCACAGAGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-871s1c1
Sequence:CCGGCGGTATGAGTCCCTGTTGTTTCTCGAGAAACAACAGGGACTCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177742
TRIML1 MISSION shRNA shRNA Plasmid DNA
tripartite motif family-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-1323s1c1
Sequence:CCGGCGTGCATAAAGTTGGTGTGTTCTCGAGAACACACCAACTTTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-153s1c1
Sequence:CCGGGCTGACCTGTTTCATCTGCTTCTCGAGAAGCAGATGAAACAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-588s1c1
Sequence:CCGGCCATGAGAAGGAACGAGTGATCTCGAGATCACTCGTTCCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-1187s1c1
Sequence:CCGGGCAAGGACTCTGTGAACAGAACTCGAGTTCTGTTCACAGAGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-871s1c1
Sequence:CCGGCGGTATGAGTCCCTGTTGTTTCTCGAGAAACAACAGGGACTCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177742
TRIML1 MISSION shRNA Lentiviral Transduction Particles
tripartite motif family-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-1323s1c1
Sequence:CCGGCGTGCATAAAGTTGGTGTGTTCTCGAGAACACACCAACTTTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-153s1c1
Sequence:CCGGGCTGACCTGTTTCATCTGCTTCTCGAGAAGCAGATGAAACAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-588s1c1
Sequence:CCGGCCATGAGAAGGAACGAGTGATCTCGAGATCACTCGTTCCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-1187s1c1
Sequence:CCGGGCAAGGACTCTGTGAACAGAACTCGAGTTCTGTTCACAGAGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177742.2-871s1c1
Sequence:CCGGCGGTATGAGTCCCTGTTGTTTCTCGAGAAACAACAGGGACTCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks