EMAIL THIS PAGE TO A FRIEND

TRIML2

tripartite motif family-like 2

Synonyms: SPRYD6
UniProtKB ID: Q8N7C3
Gene ID:
Mouse(622117) tripartite motif family-like 2
Rat(290766) tripartite motif family-like 2
domestic cat(101099545) tripartite motif family-like 2
dog(482902) tripartite motif family-like 2
naked mole-rat(101716061) tripartite motif family-like 2
domestic guinea pig(100714113) tripartite motif family-like 2
cow(520201) tripartite motif family-like 2
sheep(101110300) tripartite motif family-like 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049421 MISSION® esiRNA esiRNA human TRIML2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173553 Rosetta Predictions human pricing
XM_224883 Rosetta Predictions rat pricing
XM_886530 Rosetta Predictions mouse pricing
XM_906951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075682 predicted 449
2 SASI_Hs01_00075683 predicted 718
3 SASI_Hs01_00075684 predicted 288
4 SASI_Hs01_00075685 predicted 600
5 SASI_Hs01_00075686 predicted 547
6 SASI_Hs02_00368364 predicted 619
7 SASI_Hs02_00368365 predicted 493
8 SASI_Hs01_00075687 predicted 211
9 SASI_Hs01_00075688 predicted 294
10 SASI_Hs01_00075689 predicted 1015
11 SASI_Hs01_00075690 predicted 1018
12 SASI_Hs01_00075691 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382340 predicted 1209
2 SASI_Rn02_00382341 predicted 692
3 SASI_Rn02_00382342 predicted 1237
4 SASI_Rn02_00382343 predicted 836
5 SASI_Rn02_00382344 predicted 1544
6 SASI_Rn02_00382345 predicted 752
7 SASI_Rn02_00382346 predicted 1499
8 SASI_Rn02_00382347 predicted 899
9 SASI_Rn02_00382348 predicted 1313
10 SASI_Rn02_00382349 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428356 predicted 1221
2 SASI_Mm01_00253447 predicted 1100
3 SASI_Mm02_00428357 predicted 1365
4 SASI_Mm02_00428358 predicted 1445
5 SASI_Mm02_00428359 predicted 1353
6 SASI_Mm01_00253448 predicted 1413
7 SASI_Mm02_00428360 predicted 1131
8 SASI_Mm02_00428361 predicted 1073
9 SASI_Mm01_00253453 predicted 1268
10 SASI_Mm02_00428362 predicted 1561
11 SASI_Mm01_00253449 predicted 492
12 SASI_Mm01_00253450 predicted 594
13 SASI_Mm01_00253451 predicted 822
14 SASI_Mm01_00253452 predicted 499
15 SASI_Mm01_00253454 predicted 257
16 SASI_Mm01_00253455 predicted 1358
17 SASI_Mm01_00253456 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432936 predicted 526
2 SASI_Mm02_00432937 predicted 1107
3 SASI_Mm02_00432938 predicted 1416
4 SASI_Mm02_00432939 predicted 723
5 SASI_Mm02_00432940 predicted 823
6 SASI_Mm02_00432941 predicted 1583
7 SASI_Mm02_00432942 predicted 1055
8 SASI_Mm02_00432943 predicted 726
9 SASI_Mm02_00432944 predicted 1264
10 SASI_Mm02_00432945 predicted 1597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173553
VALIDATED
TRIML2 MISSION shRNA Bacterial Glycerol Stock
tripartite motif family-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-147s1c1
Sequence:CCGGGCAAGAAAGAATGGCGATGATCTCGAGATCATCGCCATTCTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-736s1c1
Sequence:CCGGCCAGAAAGATTGGATTTCAGTCTCGAGACTGAAATCCAATCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-109s1c1
Sequence:CCGGGAGAAACTTGAAGCAGCTAAACTCGAGTTTAGCTGCTTCAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173553.1-627s1c1
Sequence:CCGGCCAGAGACATTTAACATTGGACTCGAGTCCAATGTTAAATGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-732s1c1
Sequence:CCGGCAACCCAGAAAGATTGGATTTCTCGAGAAATCCAATCTTTCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173553
VALIDATED
TRIML2 MISSION shRNA shRNA Plasmid DNA
tripartite motif family-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-147s1c1
Sequence:CCGGGCAAGAAAGAATGGCGATGATCTCGAGATCATCGCCATTCTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-736s1c1
Sequence:CCGGCCAGAAAGATTGGATTTCAGTCTCGAGACTGAAATCCAATCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-109s1c1
Sequence:CCGGGAGAAACTTGAAGCAGCTAAACTCGAGTTTAGCTGCTTCAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173553.1-627s1c1
Sequence:CCGGCCAGAGACATTTAACATTGGACTCGAGTCCAATGTTAAATGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-732s1c1
Sequence:CCGGCAACCCAGAAAGATTGGATTTCTCGAGAAATCCAATCTTTCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173553
VALIDATED
TRIML2 MISSION shRNA Lentiviral Transduction Particles
tripartite motif family-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-147s1c1
Sequence:CCGGGCAAGAAAGAATGGCGATGATCTCGAGATCATCGCCATTCTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-736s1c1
Sequence:CCGGCCAGAAAGATTGGATTTCAGTCTCGAGACTGAAATCCAATCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-109s1c1
Sequence:CCGGGAGAAACTTGAAGCAGCTAAACTCGAGTTTAGCTGCTTCAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173553.1-627s1c1
Sequence:CCGGCCAGAGACATTTAACATTGGACTCGAGTCCAATGTTAAATGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173553.1-732s1c1
Sequence:CCGGCAACCCAGAAAGATTGGATTTCTCGAGAAATCCAATCTTTCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160412
TRIML2 MISSION shRNA Bacterial Glycerol Stock
tripartite motif family-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-1241s21c1
Sequence:CCGGGGAGCGATTAAACCAATATTTCTCGAGAAATATTGGTTTAATCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-364s21c1
Sequence:CCGGGATGATCGAGGCTGAGTATAACTCGAGTTATACTCAGCCTCGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-148s21c1
Sequence:CCGGTGATGACCAAGTCATAGTTTGCTCGAGCAAACTATGACTTGGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-414s21c1
Sequence:CCGGAGGAACTGGCAGCCTACAAAGCTCGAGCTTTGTAGGCTGCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-221s21c1
Sequence:CCGGCAAGAAGCTGCTGAGTATTACCTCGAGGTAATACTCAGCAGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160412
TRIML2 MISSION shRNA shRNA Plasmid DNA
tripartite motif family-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-1241s21c1
Sequence:CCGGGGAGCGATTAAACCAATATTTCTCGAGAAATATTGGTTTAATCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-364s21c1
Sequence:CCGGGATGATCGAGGCTGAGTATAACTCGAGTTATACTCAGCCTCGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-148s21c1
Sequence:CCGGTGATGACCAAGTCATAGTTTGCTCGAGCAAACTATGACTTGGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-414s21c1
Sequence:CCGGAGGAACTGGCAGCCTACAAAGCTCGAGCTTTGTAGGCTGCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-221s21c1
Sequence:CCGGCAAGAAGCTGCTGAGTATTACCTCGAGGTAATACTCAGCAGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160412
TRIML2 MISSION shRNA Lentiviral Transduction Particles
tripartite motif family-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-1241s21c1
Sequence:CCGGGGAGCGATTAAACCAATATTTCTCGAGAAATATTGGTTTAATCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-364s21c1
Sequence:CCGGGATGATCGAGGCTGAGTATAACTCGAGTTATACTCAGCCTCGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-148s21c1
Sequence:CCGGTGATGACCAAGTCATAGTTTGCTCGAGCAAACTATGACTTGGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-414s21c1
Sequence:CCGGAGGAACTGGCAGCCTACAAAGCTCGAGCTTTGTAGGCTGCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160412.1-221s21c1
Sequence:CCGGCAAGAAGCTGCTGAGTATTACCTCGAGGTAATACTCAGCAGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks