EMAIL THIS PAGE TO A FRIEND

TRIO

trio Rho guanine nucleotide exchange factor

Synonyms: ARHGEF23 tgat
Gene ID:
Mouse(223435) triple functional domain (PTPRF interacting)
Rat(310192) trio Rho guanine nucleotide exchange factor
fruit fly(43974) CG18214 gene product from transcript CG18214-RA
Horse(100070270) trio Rho guanine nucleotide exchange factor
domestic cat(101091173) trio Rho guanine nucleotide exchange factor
dog(478610) trio Rho guanine nucleotide exchange factor
chicken(420919) triple functional domain (PTPRF interacting)
Zebrafish(368847) triple functional domain (PTPRF interacting)
cow(538292) triple functional domain (PTPRF interacting)
sheep(101103924) trio Rho guanine nucleotide exchange factor
domestic guinea pig(100719209) trio Rho guanine nucleotide exchange factor
naked mole-rat(101698077) trio Rho guanine nucleotide exchange factor
Domestic Rabbit(100342045) trio Rho guanine nucleotide exchange factor
279 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007118 Rosetta Predictions human pricing
NM_001107658 Rosetta Predictions rat pricing
NM_001081302 Rosetta Predictions mouse pricing
XM_001474968 Rosetta Predictions mouse pricing
XM_888341 Rosetta Predictions mouse pricing
XM_898027 Rosetta Predictions mouse pricing
XM_908972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023271 predicted 1860
2 SASI_Hs01_00023272 predicted 8833
3 SASI_Hs02_00342991 predicted 3864
4 SASI_Hs01_00023273 predicted 7962
5 SASI_Hs01_00023274 predicted 5734
6 SASI_Hs01_00023275 predicted 8593
7 SASI_Hs01_00023276 predicted 2671
8 SASI_Hs01_00023277 predicted 9232
9 SASI_Hs01_00023278 predicted 8415
10 SASI_Hs01_00023279 predicted 6649
11 SASI_Hs01_00023270 predicted 9241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230995 predicted 3583
2 SASI_Rn02_00230996 predicted 3737
3 SASI_Rn02_00230997 predicted 4184
4 SASI_Rn02_00230998 predicted 3312
5 SASI_Rn02_00230999 predicted 5675
6 SASI_Rn02_00231000 predicted 4024
7 SASI_Rn02_00231001 predicted 4349
8 SASI_Rn02_00231002 predicted 3870
9 SASI_Rn02_00231003 predicted 3291
10 SASI_Rn02_00231004 predicted 4387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297121 predicted 1598
2 SASI_Mm02_00297122 predicted 8265
3 SASI_Mm02_00297123 predicted 8951
4 SASI_Mm02_00297124 predicted 8315
5 SASI_Mm02_00297125 predicted 4611
6 SASI_Mm02_00297126 predicted 6085
7 SASI_Mm02_00297127 predicted 7634
8 SASI_Mm02_00297128 predicted 9194
9 SASI_Mm02_00297129 predicted 9598
10 SASI_Mm02_00297130 predicted 4240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00379196 predicted 1598
2 SASI_Mm02_00379197 predicted 1505
3 SASI_Mm02_00379198 predicted 1326
4 SASI_Mm02_00379199 predicted 5050
5 SASI_Mm02_00379200 predicted 4527
6 SASI_Mm02_00379201 predicted 4290
7 SASI_Mm02_00379202 predicted 2370
8 SASI_Mm02_00379203 predicted 4618
9 SASI_Mm02_00379204 predicted 4518
10 SASI_Mm02_00379205 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254095 predicted 1608
2 SASI_Mm01_00254096 predicted 9699
3 SASI_Mm01_00254097 predicted 8954
4 SASI_Mm01_00254098 predicted 8327
5 SASI_Mm01_00254099 predicted 4622
6 SASI_Mm01_00254100 predicted 6082
7 SASI_Mm01_00254101 predicted 7641
8 SASI_Mm01_00254102 predicted 9205
9 SASI_Mm01_00254103 predicted 9604
10 SASI_Mm01_00254104 predicted 4244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210873 predicted 4661
2 SASI_Mm01_00210874 predicted 3284
3 SASI_Mm01_00210875 predicted 4713
4 SASI_Mm01_00210876 predicted 3969
5 SASI_Mm01_00210877 predicted 3336
6 SASI_Mm01_00210878 predicted 3562
7 SASI_Mm01_00210879 predicted 1094
8 SASI_Mm01_00210880 predicted 2654
9 SASI_Mm01_00210881 predicted 4213
10 SASI_Mm01_00210882 predicted 4610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434526 predicted 1593
2 SASI_Mm02_00434527 predicted 8261
3 SASI_Mm02_00434528 predicted 8953
4 SASI_Mm02_00434529 predicted 8312
5 SASI_Mm02_00434530 predicted 4619
6 SASI_Mm02_00434531 predicted 6078
7 SASI_Mm02_00434532 predicted 7630
8 SASI_Mm02_00434533 predicted 9190
9 SASI_Mm02_00434534 predicted 9591
10 SASI_Mm02_00434535 predicted 4244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007118
VALIDATED
TRIO MISSION shRNA Bacterial Glycerol Stock
trio Rho guanine nucleotide exchange factor
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9867s21c1
Sequence:CCGGGATGAAATGTAGGCCTTACTTCTCGAGAAGTAAGGCCTACATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007118.2-9035s21c1
Sequence:CCGGGCTTCCCAGATGACTACTTTACTCGAGTAAAGTAGTCATCTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007118.2-633s21c1
Sequence:CCGGCCACGAAGAATGGATTGAAATCTCGAGATTTCAATCCATTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9372s21c1
Sequence:CCGGCAAGCAAACATAACTGATCAGCTCGAGCTGATCAGTTATGTTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9519s21c1
Sequence:CCGGGCATTGCTGTATCACAGTATTCTCGAGAATACTGTGATACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-8387s1c1
Sequence:CCGGGCTTCCCAGATGACTACTTTACTCGAGTAAAGTAGTCATCTGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-7377s1c1
Sequence:CCGGGCTTCTCAATCCCAACTACATCTCGAGATGTAGTTGGGATTGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.x-1265s1c1
Sequence:CCGGGCAACGTGGATTCATGGTGTACTCGAGTACACCATGAATCCACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-1738s1c1
Sequence:CCGGGCACAGAACACATACACCAATCTCGAGATTGGTGTATGTGTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-8724s1c1
Sequence:CCGGCAAGCAAACATAACTGATCAGCTCGAGCTGATCAGTTATGTTTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.2-3757s1c1
Sequence:CCGGGATTCCAACAAATCGAGTAAACTCGAGTTTACTCGATTTGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-9867s1c1
Sequence:CCGGGATGAAATGTAGGCCTTACTTCTCGAGAAGTAAGGCCTACATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-9519s1c1
Sequence:CCGGGCATTGCTGTATCACAGTATTCTCGAGAATACTGTGATACAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.2-5828s1c1
Sequence:CCGGCCTTCAACCCTTCGGATAATTCTCGAGAATTATCCGAAGGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-633s1c1
Sequence:CCGGCCACGAAGAATGGATTGAAATCTCGAGATTTCAATCCATTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007118.2-9197s1c1
Sequence:CCGGCCAGACTGACTTCCTTCATTGCTCGAGCAATGAAGGAAGTCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007118
VALIDATED
TRIO MISSION shRNA shRNA Plasmid DNA
trio Rho guanine nucleotide exchange factor
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9867s21c1
Sequence:CCGGGATGAAATGTAGGCCTTACTTCTCGAGAAGTAAGGCCTACATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007118.2-9035s21c1
Sequence:CCGGGCTTCCCAGATGACTACTTTACTCGAGTAAAGTAGTCATCTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007118.2-633s21c1
Sequence:CCGGCCACGAAGAATGGATTGAAATCTCGAGATTTCAATCCATTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9372s21c1
Sequence:CCGGCAAGCAAACATAACTGATCAGCTCGAGCTGATCAGTTATGTTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9519s21c1
Sequence:CCGGGCATTGCTGTATCACAGTATTCTCGAGAATACTGTGATACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-8387s1c1
Sequence:CCGGGCTTCCCAGATGACTACTTTACTCGAGTAAAGTAGTCATCTGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-7377s1c1
Sequence:CCGGGCTTCTCAATCCCAACTACATCTCGAGATGTAGTTGGGATTGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.x-1265s1c1
Sequence:CCGGGCAACGTGGATTCATGGTGTACTCGAGTACACCATGAATCCACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-1738s1c1
Sequence:CCGGGCACAGAACACATACACCAATCTCGAGATTGGTGTATGTGTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-8724s1c1
Sequence:CCGGCAAGCAAACATAACTGATCAGCTCGAGCTGATCAGTTATGTTTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.2-3757s1c1
Sequence:CCGGGATTCCAACAAATCGAGTAAACTCGAGTTTACTCGATTTGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-9867s1c1
Sequence:CCGGGATGAAATGTAGGCCTTACTTCTCGAGAAGTAAGGCCTACATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-9519s1c1
Sequence:CCGGGCATTGCTGTATCACAGTATTCTCGAGAATACTGTGATACAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.2-5828s1c1
Sequence:CCGGCCTTCAACCCTTCGGATAATTCTCGAGAATTATCCGAAGGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-633s1c1
Sequence:CCGGCCACGAAGAATGGATTGAAATCTCGAGATTTCAATCCATTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007118.2-9197s1c1
Sequence:CCGGCCAGACTGACTTCCTTCATTGCTCGAGCAATGAAGGAAGTCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007118
VALIDATED
TRIO MISSION shRNA Lentiviral Transduction Particles
trio Rho guanine nucleotide exchange factor
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9867s21c1
Sequence:CCGGGATGAAATGTAGGCCTTACTTCTCGAGAAGTAAGGCCTACATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007118.2-9035s21c1
Sequence:CCGGGCTTCCCAGATGACTACTTTACTCGAGTAAAGTAGTCATCTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007118.2-633s21c1
Sequence:CCGGCCACGAAGAATGGATTGAAATCTCGAGATTTCAATCCATTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9372s21c1
Sequence:CCGGCAAGCAAACATAACTGATCAGCTCGAGCTGATCAGTTATGTTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007118.2-9519s21c1
Sequence:CCGGGCATTGCTGTATCACAGTATTCTCGAGAATACTGTGATACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-8387s1c1
Sequence:CCGGGCTTCCCAGATGACTACTTTACTCGAGTAAAGTAGTCATCTGGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-7377s1c1
Sequence:CCGGGCTTCTCAATCCCAACTACATCTCGAGATGTAGTTGGGATTGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.x-1265s1c1
Sequence:CCGGGCAACGTGGATTCATGGTGTACTCGAGTACACCATGAATCCACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-1738s1c1
Sequence:CCGGGCACAGAACACATACACCAATCTCGAGATTGGTGTATGTGTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.x-8724s1c1
Sequence:CCGGCAAGCAAACATAACTGATCAGCTCGAGCTGATCAGTTATGTTTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.2-3757s1c1
Sequence:CCGGGATTCCAACAAATCGAGTAAACTCGAGTTTACTCGATTTGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-9867s1c1
Sequence:CCGGGATGAAATGTAGGCCTTACTTCTCGAGAAGTAAGGCCTACATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-9519s1c1
Sequence:CCGGGCATTGCTGTATCACAGTATTCTCGAGAATACTGTGATACAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007118.2-5828s1c1
Sequence:CCGGCCTTCAACCCTTCGGATAATTCTCGAGAATTATCCGAAGGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007118.2-633s1c1
Sequence:CCGGCCACGAAGAATGGATTGAAATCTCGAGATTTCAATCCATTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007118.2-9197s1c1
Sequence:CCGGCCAGACTGACTTCCTTCATTGCTCGAGCAATGAAGGAAGTCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081302
VALIDATED
TRIO MISSION shRNA Bacterial Glycerol Stock
trio Rho guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081302.1-2210s21c1
Sequence:CCGGACGTACACAAACGCAGATAAACTCGAGTTTATCTGCGTTTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081302.1-10728s21c1
Sequence:CCGGACACTTAACTCTTCGTGAAATCTCGAGATTTCACGAAGAGTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081302.1-9607s21c1
Sequence:CCGGTCGACCTATCCGTAGCATTAACTCGAGTTAATGCTACGGATAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081302.1-1592s21c1
Sequence:CCGGTACGCCTCTCAGCAGATTAAGCTCGAGCTTAATCTGCTGAGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081302.1-6761s21c1
Sequence:CCGGATCGTGCCGAAGCGCTGTAATCTCGAGATTACAGCGCTTCGGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081302
VALIDATED
TRIO MISSION shRNA shRNA Plasmid DNA
trio Rho guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081302.1-2210s21c1
Sequence:CCGGACGTACACAAACGCAGATAAACTCGAGTTTATCTGCGTTTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081302.1-10728s21c1
Sequence:CCGGACACTTAACTCTTCGTGAAATCTCGAGATTTCACGAAGAGTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081302.1-9607s21c1
Sequence:CCGGTCGACCTATCCGTAGCATTAACTCGAGTTAATGCTACGGATAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081302.1-1592s21c1
Sequence:CCGGTACGCCTCTCAGCAGATTAAGCTCGAGCTTAATCTGCTGAGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081302.1-6761s21c1
Sequence:CCGGATCGTGCCGAAGCGCTGTAATCTCGAGATTACAGCGCTTCGGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081302
VALIDATED
TRIO MISSION shRNA Lentiviral Transduction Particles
trio Rho guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081302.1-2210s21c1
Sequence:CCGGACGTACACAAACGCAGATAAACTCGAGTTTATCTGCGTTTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081302.1-10728s21c1
Sequence:CCGGACACTTAACTCTTCGTGAAATCTCGAGATTTCACGAAGAGTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081302.1-9607s21c1
Sequence:CCGGTCGACCTATCCGTAGCATTAACTCGAGTTAATGCTACGGATAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081302.1-1592s21c1
Sequence:CCGGTACGCCTCTCAGCAGATTAAGCTCGAGCTTAATCTGCTGAGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081302.1-6761s21c1
Sequence:CCGGATCGTGCCGAAGCGCTGTAATCTCGAGATTACAGCGCTTCGGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks