EMAIL THIS PAGE TO A FRIEND

TRIOBP

TRIO and F-actin binding protein

Synonyms: DFNB28 TARA dJ37E16.4
Gene ID:
Human(11078) Summary: This gene encodes a protein with an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. The protein interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility and cell growth. The protein also associates with F-actin and stabilizes F-actin structures. Mutations in this gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants that would encode different isoforms have been found for this gene, however some transcripts may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Nov 2008]
Mouse(110253) TRIO and F-actin binding protein
Rat(362956) TRIO and F-actin binding protein
Domestic Rabbit(100354753) TRIO and F-actin binding protein
naked mole-rat(101717848) TRIO and F-actin binding protein
domestic guinea pig(100722903) TRIO and F-actin binding protein
cow(511680) TRIO and F-actin binding protein
sheep(101119130) TRIO and F-actin binding protein
Zebrafish(790927) TRIO and F-actin binding protein
dog(481263) TRIO and F-actin binding protein
domestic cat(101094113) TRIO and F-actin binding protein
Horse(100069858) TRIO and F-actin binding protein
chicken(418035) TRIO and F-actin binding protein
Gene Class: Cytoskeleton
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138632 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039141 Rosetta Predictions human pricing
NM_007032 Rosetta Predictions human pricing
NM_138632 Rosetta Predictions human pricing
XM_001065869 Rosetta Predictions rat pricing
XM_001076290 Rosetta Predictions rat pricing
NM_001024716 Rosetta Predictions mouse pricing
NM_001039155 Rosetta Predictions mouse pricing
NM_001039156 Rosetta Predictions mouse pricing
NM_138579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171679 predicted 5704
2 SASI_Hs01_00171680 predicted 5722
3 SASI_Hs01_00171681 predicted 5813
4 SASI_Hs01_00171682 predicted 6188
5 SASI_Hs01_00171683 predicted 5764
6 SASI_Hs02_00308437 predicted 5819
7 SASI_Hs01_00171685 predicted 5712
8 SASI_Hs01_00171687 predicted 6191
9 SASI_Hs02_00308438 predicted 5696
10 SASI_Hs01_00171688 predicted 5766
11 SASI_Hs01_00171684 predicted 5792
12 SASI_Hs01_00171686 predicted 6098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078650 predicted 437
2 SASI_Hs01_00078651 predicted 446
3 SASI_Hs01_00078652 predicted 541
4 SASI_Hs01_00078653 predicted 921
5 SASI_Hs01_00078654 predicted 488
6 SASI_Hs02_00342808 predicted 540
7 SASI_Hs01_00078656 predicted 434
8 SASI_Hs01_00078658 predicted 927
9 SASI_Hs02_00342809 predicted 420
10 SASI_Hs01_00078659 predicted 492
11 SASI_Hs01_00078655 predicted 512
12 SASI_Hs01_00078657 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037749 predicted 435
2 SASI_Hs01_00037750 predicted 454
3 SASI_Hs01_00037751 predicted 543
4 SASI_Hs01_00037752 predicted 923
5 SASI_Hs01_00037753 predicted 497
6 SASI_Hs02_00363760 predicted 548
7 SASI_Hs01_00037755 predicted 438
8 SASI_Hs01_00037757 predicted 919
9 SASI_Hs02_00363761 predicted 422
10 SASI_Hs01_00037758 predicted 487
11 SASI_Hs01_00037754 predicted 522
12 SASI_Hs01_00037756 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315554 predicted 469
2 SASI_Rn02_00315555 predicted 224
3 SASI_Rn02_00315556 predicted 658
4 SASI_Rn02_00315557 predicted 338
5 SASI_Rn02_00315558 predicted 613
6 SASI_Rn02_00315559 predicted 370
7 SASI_Rn02_00315560 predicted 404
8 SASI_Rn02_00315561 predicted 586
9 SASI_Rn02_00315562 predicted 358
10 SASI_Rn02_00315563 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352716 predicted 3402
2 SASI_Rn02_00352717 predicted 1591
3 SASI_Rn02_00352718 predicted 1099
4 SASI_Rn02_00352719 predicted 1957
5 SASI_Rn02_00352720 predicted 992
6 SASI_Rn02_00352721 predicted 322
7 SASI_Rn02_00352722 predicted 1633
8 SASI_Rn02_00352723 predicted 4633
9 SASI_Rn02_00352724 predicted 1279
10 SASI_Rn02_00352725 predicted 5349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090312 predicted 1293
2 SASI_Mm01_00090313 predicted 1370
3 SASI_Mm01_00090314 predicted 860
4 SASI_Mm01_00090315 predicted 416
5 SASI_Mm01_00090316 predicted 520
6 SASI_Mm01_00090317 predicted 926
7 SASI_Mm01_00090318 predicted 631
8 SASI_Mm01_00090320 predicted 1276
9 SASI_Mm01_00090321 predicted 378
10 SASI_Mm02_00287685 predicted 1594
11 SASI_Mm01_00090319 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178319 predicted 2562
2 SASI_Mm01_00178320 predicted 3072
3 SASI_Mm01_00178321 predicted 2234
4 SASI_Mm01_00178322 predicted 1643
5 SASI_Mm01_00178323 predicted 1317
6 SASI_Mm01_00178324 predicted 2876
7 SASI_Mm01_00178325 predicted 2143
8 SASI_Mm01_00178326 predicted 2880
9 SASI_Mm01_00178327 predicted 1723
10 SASI_Mm01_00178328 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149039 predicted 2560
2 SASI_Mm01_00149040 predicted 3079
3 SASI_Mm01_00149041 predicted 2228
4 SASI_Mm01_00149042 predicted 1650
5 SASI_Mm01_00149043 predicted 1314
6 SASI_Mm01_00149044 predicted 2878
7 SASI_Mm01_00149045 predicted 2143
8 SASI_Mm01_00149046 predicted 2881
9 SASI_Mm01_00149047 predicted 1723
10 SASI_Mm01_00149048 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339616 predicted 5927
2 SASI_Mm02_00339617 predicted 5993
3 SASI_Mm02_00339618 predicted 5491
4 SASI_Mm02_00339619 predicted 5039
5 SASI_Mm02_00339620 predicted 5144
6 SASI_Mm02_00339621 predicted 5548
7 SASI_Mm02_00339622 predicted 5255
8 SASI_Mm02_00339623 predicted 5903
9 SASI_Mm02_00339624 predicted 5004
10 SASI_Mm02_00339625 predicted 6216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138579
VALIDATED
TRIOBP MISSION shRNA Bacterial Glycerol Stock
TRIO and F-actin binding protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-2136s1c1
Sequence:CCGGCCTTGCACCTTCTTCAGGATTCTCGAGAATCCTGAAGAAGGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1260s1c1
Sequence:CCGGGCCATGAAGAAGGCGTATCAACTCGAGTTGATACGCCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1086s1c1
Sequence:CCGGCCAGGCTACATCTCGCAGGAACTCGAGTTCCTGCGAGATGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1643s1c1
Sequence:CCGGGAAGGAGAATGAACTCCAGTACTCGAGTACTGGAGTTCATTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-218s1c1
Sequence:CCGGGACGGATTCAAGCCTCAAATACTCGAGTATTTGAGGCTTGAATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138579.4-6781s21c1
Sequence:CCGGCCTTGCACCTTCTTCAGGATTCTCGAGAATCCTGAAGAAGGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138579.4-5905s21c1
Sequence:CCGGGCCATGAAGAAGGCGTATCAACTCGAGTTGATACGCCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138579.4-4863s21c1
Sequence:CCGGGACGGATTCAAGCCTCAAATACTCGAGTATTTGAGGCTTGAATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138579
VALIDATED
TRIOBP MISSION shRNA shRNA Plasmid DNA
TRIO and F-actin binding protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-2136s1c1
Sequence:CCGGCCTTGCACCTTCTTCAGGATTCTCGAGAATCCTGAAGAAGGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1260s1c1
Sequence:CCGGGCCATGAAGAAGGCGTATCAACTCGAGTTGATACGCCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1086s1c1
Sequence:CCGGCCAGGCTACATCTCGCAGGAACTCGAGTTCCTGCGAGATGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1643s1c1
Sequence:CCGGGAAGGAGAATGAACTCCAGTACTCGAGTACTGGAGTTCATTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-218s1c1
Sequence:CCGGGACGGATTCAAGCCTCAAATACTCGAGTATTTGAGGCTTGAATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138579.4-6781s21c1
Sequence:CCGGCCTTGCACCTTCTTCAGGATTCTCGAGAATCCTGAAGAAGGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138579.4-5905s21c1
Sequence:CCGGGCCATGAAGAAGGCGTATCAACTCGAGTTGATACGCCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138579.4-4863s21c1
Sequence:CCGGGACGGATTCAAGCCTCAAATACTCGAGTATTTGAGGCTTGAATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138579
VALIDATED
TRIOBP MISSION shRNA Lentiviral Transduction Particles
TRIO and F-actin binding protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-2136s1c1
Sequence:CCGGCCTTGCACCTTCTTCAGGATTCTCGAGAATCCTGAAGAAGGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1260s1c1
Sequence:CCGGGCCATGAAGAAGGCGTATCAACTCGAGTTGATACGCCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1086s1c1
Sequence:CCGGCCAGGCTACATCTCGCAGGAACTCGAGTTCCTGCGAGATGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-1643s1c1
Sequence:CCGGGAAGGAGAATGAACTCCAGTACTCGAGTACTGGAGTTCATTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138579.2-218s1c1
Sequence:CCGGGACGGATTCAAGCCTCAAATACTCGAGTATTTGAGGCTTGAATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138579.4-6781s21c1
Sequence:CCGGCCTTGCACCTTCTTCAGGATTCTCGAGAATCCTGAAGAAGGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138579.4-5905s21c1
Sequence:CCGGGCCATGAAGAAGGCGTATCAACTCGAGTTGATACGCCTTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138579.4-4863s21c1
Sequence:CCGGGACGGATTCAAGCCTCAAATACTCGAGTATTTGAGGCTTGAATCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138632
VALIDATED
TRIOBP MISSION shRNA Bacterial Glycerol Stock
TRIO and F-actin binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-1272s1c1
Sequence:CCGGCAGGTCTCAAAGGTGGGATTTCTCGAGAAATCCCACCTTTGAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138632.1-1586s1c1
Sequence:CCGGTGTCACAACTAGGACAAACTACTCGAGTAGTTTGTCCTAGTTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-287s1c1
Sequence:CCGGCATTGGTTTGTGCTGACAGATCTCGAGATCTGTCAGCACAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-550s1c1
Sequence:CCGGCTCGGACTCTAACAAGGAGAACTCGAGTTCTCCTTGTTAGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-298s1c1
Sequence:CCGGGCTGACAGATTCAAGTCTCAACTCGAGTTGAGACTTGAATCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138632.2-556s21c1
Sequence:CCGGCTCGGACTCTAACAAGGAGAACTCGAGTTCTCCTTGTTAGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_138632.2-304s21c1
Sequence:CCGGGCTGACAGATTCAAGTCTCAACTCGAGTTGAGACTTGAATCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138632.2-1563s21c1
Sequence:CCGGATTTGGCTGTGTCTGGGAATACTCGAGTATTCCCAGACACAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138632.2-1231s21c1
Sequence:CCGGACTGAGCTCTGAGAGGTTATGCTCGAGCATAACCTCTCAGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138632
VALIDATED
TRIOBP MISSION shRNA shRNA Plasmid DNA
TRIO and F-actin binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-1272s1c1
Sequence:CCGGCAGGTCTCAAAGGTGGGATTTCTCGAGAAATCCCACCTTTGAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138632.1-1586s1c1
Sequence:CCGGTGTCACAACTAGGACAAACTACTCGAGTAGTTTGTCCTAGTTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-287s1c1
Sequence:CCGGCATTGGTTTGTGCTGACAGATCTCGAGATCTGTCAGCACAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-550s1c1
Sequence:CCGGCTCGGACTCTAACAAGGAGAACTCGAGTTCTCCTTGTTAGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-298s1c1
Sequence:CCGGGCTGACAGATTCAAGTCTCAACTCGAGTTGAGACTTGAATCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138632.2-556s21c1
Sequence:CCGGCTCGGACTCTAACAAGGAGAACTCGAGTTCTCCTTGTTAGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_138632.2-304s21c1
Sequence:CCGGGCTGACAGATTCAAGTCTCAACTCGAGTTGAGACTTGAATCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138632.2-1563s21c1
Sequence:CCGGATTTGGCTGTGTCTGGGAATACTCGAGTATTCCCAGACACAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138632.2-1231s21c1
Sequence:CCGGACTGAGCTCTGAGAGGTTATGCTCGAGCATAACCTCTCAGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138632
VALIDATED
TRIOBP MISSION shRNA Lentiviral Transduction Particles
TRIO and F-actin binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-1272s1c1
Sequence:CCGGCAGGTCTCAAAGGTGGGATTTCTCGAGAAATCCCACCTTTGAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138632.1-1586s1c1
Sequence:CCGGTGTCACAACTAGGACAAACTACTCGAGTAGTTTGTCCTAGTTGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-287s1c1
Sequence:CCGGCATTGGTTTGTGCTGACAGATCTCGAGATCTGTCAGCACAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-550s1c1
Sequence:CCGGCTCGGACTCTAACAAGGAGAACTCGAGTTCTCCTTGTTAGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138632.1-298s1c1
Sequence:CCGGGCTGACAGATTCAAGTCTCAACTCGAGTTGAGACTTGAATCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138632.2-556s21c1
Sequence:CCGGCTCGGACTCTAACAAGGAGAACTCGAGTTCTCCTTGTTAGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_138632.2-304s21c1
Sequence:CCGGGCTGACAGATTCAAGTCTCAACTCGAGTTGAGACTTGAATCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138632.2-1563s21c1
Sequence:CCGGATTTGGCTGTGTCTGGGAATACTCGAGTATTCCCAGACACAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138632.2-1231s21c1
Sequence:CCGGACTGAGCTCTGAGAGGTTATGCTCGAGCATAACCTCTCAGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks