EMAIL THIS PAGE TO A FRIEND

TRIP10

thyroid hormone receptor interactor 10

Synonyms: CIP4 HSTP STOT STP
Gene ID:
Mouse(106628) thyroid hormone receptor interactor 10
Rat(116717) thyroid hormone receptor interactor 10
domestic cat(101088727) thyroid hormone receptor interactor 10
Horse(100060571) thyroid hormone receptor interactor 10
dog(476726) thyroid hormone receptor interactor 10
cow(533171) thyroid hormone receptor interactor 10
sheep(101107865) thyroid hormone receptor interactor 10
domestic guinea pig(100712771) thyroid hormone receptor interactor 10
naked mole-rat(101698955) thyroid hormone receptor interactor 10
Gene Class: Cytoskeleton
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004240 Rosetta Predictions human pricing
NM_053920 Rosetta Predictions rat pricing
XM_579584 Rosetta Predictions rat pricing
NM_134125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189708 predicted 826
2 SASI_Hs01_00189709 predicted 811
3 SASI_Hs01_00189710 predicted 463
4 SASI_Hs01_00189711 predicted 1250
5 SASI_Hs02_00337174 predicted 356
6 SASI_Hs01_00189713 predicted 789
7 SASI_Hs01_00189715 predicted 1118
8 SASI_Hs01_00189716 predicted 280
9 SASI_Hs01_00189717 predicted 690
10 SASI_Hs02_00337175 predicted 374
11 SASI_Hs01_00189712 predicted 1584
12 SASI_Hs01_00189714 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041914 predicted 799
2 SASI_Rn01_00041915 predicted 438
3 SASI_Rn01_00041916 predicted 902
4 SASI_Rn01_00041917 predicted 449
5 SASI_Rn01_00041919 predicted 649
6 SASI_Rn01_00041920 predicted 770
7 SASI_Rn01_00041921 predicted 238
8 SASI_Rn01_00041922 predicted 1457
9 SASI_Rn01_00041923 predicted 775
10 SASI_Rn02_00266863 predicted 1468
11 SASI_Rn01_00041918 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167838 predicted 346
2 SASI_Rn01_00167839 predicted 443
3 SASI_Rn01_00167840 predicted 449
4 SASI_Rn01_00167841 predicted 462
5 SASI_Rn01_00167842 predicted 249
6 SASI_Rn01_00167843 predicted 388
7 SASI_Rn01_00167844 predicted 452
8 SASI_Rn01_00167845 predicted 336
9 SASI_Rn01_00167846 predicted 354
10 SASI_Rn01_00167847 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187513 predicted 521
2 SASI_Mm01_00187514 predicted 946
3 SASI_Mm01_00187515 predicted 481
4 SASI_Mm01_00187516 predicted 1299
5 SASI_Mm01_00187517 predicted 839
6 SASI_Mm01_00187518 predicted 816
7 SASI_Mm01_00187519 predicted 1507
8 SASI_Mm01_00187520 predicted 566
9 SASI_Mm02_00339368 predicted 1201
10 SASI_Mm01_00187521 predicted 1339
11 SASI_Mm01_00187512 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004240
VALIDATED
TRIP10 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-342s21c1
Sequence:CCGGGAACCTCAGTGTCCGTGTATGCTCGAGCATACACGGACACTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-1800s21c1
Sequence:CCGGTTCGGCTGAGACCTGTGTAACCTCGAGGTTACACAGGTCTCAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004240.2-1682s21c1
Sequence:CCGGACCTCCGAGTCACGCTCAATTCTCGAGAATTGAGCGTGACTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-465s21c1
Sequence:CCGGGCTGGAGAATAGTAAGCGTAACTCGAGTTACGCTTACTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-135s21c1
Sequence:CCGGCCTGTTGGACAGATATGTAAACTCGAGTTTACATATCTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004240.2-135s1c1
Sequence:CCGGCCTGTTGGACAGATATGTAAACTCGAGTTTACATATCTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004240.2-792s1c1
Sequence:CCGGGCCCATAATAGCCAAGTGCTTCTCGAGAAGCACTTGGCTATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004240.2-864s1c1
Sequence:CCGGCGTCCTTATAGAGCTGCACAACTCGAGTTGTGCAGCTCTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004240.2-465s1c1
Sequence:CCGGGCTGGAGAATAGTAAGCGTAACTCGAGTTACGCTTACTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004240
VALIDATED
TRIP10 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-342s21c1
Sequence:CCGGGAACCTCAGTGTCCGTGTATGCTCGAGCATACACGGACACTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-1800s21c1
Sequence:CCGGTTCGGCTGAGACCTGTGTAACCTCGAGGTTACACAGGTCTCAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004240.2-1682s21c1
Sequence:CCGGACCTCCGAGTCACGCTCAATTCTCGAGAATTGAGCGTGACTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-465s21c1
Sequence:CCGGGCTGGAGAATAGTAAGCGTAACTCGAGTTACGCTTACTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-135s21c1
Sequence:CCGGCCTGTTGGACAGATATGTAAACTCGAGTTTACATATCTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004240.2-135s1c1
Sequence:CCGGCCTGTTGGACAGATATGTAAACTCGAGTTTACATATCTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004240.2-792s1c1
Sequence:CCGGGCCCATAATAGCCAAGTGCTTCTCGAGAAGCACTTGGCTATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004240.2-864s1c1
Sequence:CCGGCGTCCTTATAGAGCTGCACAACTCGAGTTGTGCAGCTCTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004240.2-465s1c1
Sequence:CCGGGCTGGAGAATAGTAAGCGTAACTCGAGTTACGCTTACTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004240
VALIDATED
TRIP10 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-342s21c1
Sequence:CCGGGAACCTCAGTGTCCGTGTATGCTCGAGCATACACGGACACTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-1800s21c1
Sequence:CCGGTTCGGCTGAGACCTGTGTAACCTCGAGGTTACACAGGTCTCAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004240.2-1682s21c1
Sequence:CCGGACCTCCGAGTCACGCTCAATTCTCGAGAATTGAGCGTGACTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-465s21c1
Sequence:CCGGGCTGGAGAATAGTAAGCGTAACTCGAGTTACGCTTACTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004240.2-135s21c1
Sequence:CCGGCCTGTTGGACAGATATGTAAACTCGAGTTTACATATCTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004240.2-135s1c1
Sequence:CCGGCCTGTTGGACAGATATGTAAACTCGAGTTTACATATCTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004240.2-792s1c1
Sequence:CCGGGCCCATAATAGCCAAGTGCTTCTCGAGAAGCACTTGGCTATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004240.2-864s1c1
Sequence:CCGGCGTCCTTATAGAGCTGCACAACTCGAGTTGTGCAGCTCTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004240.2-465s1c1
Sequence:CCGGGCTGGAGAATAGTAAGCGTAACTCGAGTTACGCTTACTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134125
VALIDATED
TRIP10 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134125.3-1842s21c1
Sequence:CCGGTTTGGCTGAGACCTGTGTAACCTCGAGGTTACACAGGTCTCAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134125.3-905s21c1
Sequence:CCGGGAATTACACAAGTCCGGGTTTCTCGAGAAACCCGGACTTGTGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-1081s21c1
Sequence:CCGGGACCGTGGCTACCGAAGATTTCTCGAGAAATCTTCGGTAGCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-1567s21c1
Sequence:CCGGGTGTGTGGCTATCTACCATTTCTCGAGAAATGGTAGATAGCCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-160s21c1
Sequence:CCGGGCTGGATTTGTTGGACAAATACTCGAGTATTTGTCCAACAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-162s1c1
Sequence:CCGGGCTGGATTTGTTGGACAAATACTCGAGTATTTGTCCAACAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134125.1-946s1c1
Sequence:CCGGGAATTTGAAGACTTTAGCCAACTCGAGTTGGCTAAAGTCTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-907s1c1
Sequence:CCGGGAATTACACAAGTCCGGGTTTCTCGAGAAACCCGGACTTGTGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-1569s1c1
Sequence:CCGGGTGTGTGGCTATCTACCATTTCTCGAGAAATGGTAGATAGCCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134125
VALIDATED
TRIP10 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134125.3-1842s21c1
Sequence:CCGGTTTGGCTGAGACCTGTGTAACCTCGAGGTTACACAGGTCTCAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134125.3-905s21c1
Sequence:CCGGGAATTACACAAGTCCGGGTTTCTCGAGAAACCCGGACTTGTGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-1081s21c1
Sequence:CCGGGACCGTGGCTACCGAAGATTTCTCGAGAAATCTTCGGTAGCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-1567s21c1
Sequence:CCGGGTGTGTGGCTATCTACCATTTCTCGAGAAATGGTAGATAGCCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-160s21c1
Sequence:CCGGGCTGGATTTGTTGGACAAATACTCGAGTATTTGTCCAACAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-162s1c1
Sequence:CCGGGCTGGATTTGTTGGACAAATACTCGAGTATTTGTCCAACAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134125.1-946s1c1
Sequence:CCGGGAATTTGAAGACTTTAGCCAACTCGAGTTGGCTAAAGTCTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-907s1c1
Sequence:CCGGGAATTACACAAGTCCGGGTTTCTCGAGAAACCCGGACTTGTGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-1569s1c1
Sequence:CCGGGTGTGTGGCTATCTACCATTTCTCGAGAAATGGTAGATAGCCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134125
VALIDATED
TRIP10 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134125.3-1842s21c1
Sequence:CCGGTTTGGCTGAGACCTGTGTAACCTCGAGGTTACACAGGTCTCAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134125.3-905s21c1
Sequence:CCGGGAATTACACAAGTCCGGGTTTCTCGAGAAACCCGGACTTGTGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-1081s21c1
Sequence:CCGGGACCGTGGCTACCGAAGATTTCTCGAGAAATCTTCGGTAGCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-1567s21c1
Sequence:CCGGGTGTGTGGCTATCTACCATTTCTCGAGAAATGGTAGATAGCCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134125.3-160s21c1
Sequence:CCGGGCTGGATTTGTTGGACAAATACTCGAGTATTTGTCCAACAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-162s1c1
Sequence:CCGGGCTGGATTTGTTGGACAAATACTCGAGTATTTGTCCAACAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134125.1-946s1c1
Sequence:CCGGGAATTTGAAGACTTTAGCCAACTCGAGTTGGCTAAAGTCTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-907s1c1
Sequence:CCGGGAATTACACAAGTCCGGGTTTCTCGAGAAACCCGGACTTGTGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134125.1-1569s1c1
Sequence:CCGGGTGTGTGGCTATCTACCATTTCTCGAGAAATGGTAGATAGCCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks