EMAIL THIS PAGE TO A FRIEND

TRIP11

thyroid hormone receptor interactor 11

Synonyms: ACG1A CEV14 GMAP-210 TRIP-11 TRIP230
UniProtKB ID: Q15643, O14689, O15154, O95949
Gene ID:
Human(9321) Summary: This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
Mouse(109181) thyroid hormone receptor interactor 11
Rat(314393) thyroid hormone receptor interactor 11
naked mole-rat(101724363) thyroid hormone receptor interactor 11
Domestic Rabbit(100347085) thyroid hormone receptor interactor 11
domestic guinea pig(100719465) thyroid hormone receptor interactor 11
cow(786759) thyroid hormone receptor interactor 11
sheep(101113176) thyroid hormone receptor interactor 11
Zebrafish(100537975) thyroid hormone receptor interactor 11
domestic cat(101086657) thyroid hormone receptor interactor 11
dog(480228) thyroid hormone receptor interactor 11
chicken(423414) thyroid hormone receptor interactor 11
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001001171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001001171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001001171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004239 Rosetta Predictions human pricing
XM_001065684 Rosetta Predictions rat pricing
XM_234490 Rosetta Predictions rat pricing
XM_001001171 Rosetta Predictions mouse pricing
XM_901487 Rosetta Predictions mouse pricing
XM_912718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148052 predicted 3861
2 SASI_Hs01_00148053 predicted 3548
3 SASI_Hs01_00148054 predicted 4793
4 SASI_Hs01_00148055 predicted 4088
5 SASI_Hs01_00148056 predicted 2505
6 SASI_Hs01_00148057 predicted 5700
7 SASI_Hs01_00148058 predicted 624
8 SASI_Hs01_00148059 predicted 2473
9 SASI_Hs01_00148060 predicted 5054
10 SASI_Hs02_00337173 predicted 2521
11 SASI_Hs01_00148061 predicted 3067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315013 predicted 2279
2 SASI_Rn02_00315014 predicted 2263
3 SASI_Rn02_00315015 predicted 4692
4 SASI_Rn02_00315016 predicted 3609
5 SASI_Rn02_00315017 predicted 1514
6 SASI_Rn02_00315018 predicted 3726
7 SASI_Rn02_00315019 predicted 3097
8 SASI_Rn02_00315020 predicted 3377
9 SASI_Rn02_00315021 predicted 2097
10 SASI_Rn02_00315022 predicted 3338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388529 predicted 2276
2 SASI_Rn02_00388530 predicted 2259
3 SASI_Rn02_00388531 predicted 4686
4 SASI_Rn02_00388532 predicted 3604
5 SASI_Rn02_00388533 predicted 1514
6 SASI_Rn02_00388534 predicted 3732
7 SASI_Rn02_00388535 predicted 3096
8 SASI_Rn02_00388536 predicted 3375
9 SASI_Rn02_00388537 predicted 2090
10 SASI_Rn02_00388538 predicted 3343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355014 predicted 4048
2 SASI_Mm02_00355015 predicted 2017
3 SASI_Mm02_00355016 predicted 2365
4 SASI_Mm02_00355017 predicted 1150
5 SASI_Mm02_00355018 predicted 4565
6 SASI_Mm02_00355019 predicted 1094
7 SASI_Mm02_00355020 predicted 4992
8 SASI_Mm02_00355021 predicted 3434
9 SASI_Mm02_00355022 predicted 3416
10 SASI_Mm02_00355023 predicted 5302
11 SASI_Mm01_00258649 predicted 1102
12 SASI_Mm01_00258650 predicted 974
13 SASI_Mm01_00258651 predicted 1063
14 SASI_Mm01_00258652 predicted 1007
15 SASI_Mm01_00258653 predicted 1018
16 SASI_Mm01_00258654 predicted 1103
17 SASI_Mm01_00258655 predicted 1015
18 SASI_Mm01_00258656 predicted 1075
19 SASI_Mm01_00258657 predicted 1046
20 SASI_Mm01_00258658 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260418 predicted 1061
2 SASI_Mm01_00260419 predicted 978
3 SASI_Mm01_00260420 predicted 1103
4 SASI_Mm01_00260421 predicted 1013
5 SASI_Mm01_00260422 predicted 1022
6 SASI_Mm01_00260423 predicted 1097
7 SASI_Mm01_00260424 predicted 1016
8 SASI_Mm01_00260425 predicted 1044
9 SASI_Mm01_00260426 predicted 1056
10 SASI_Mm01_00260427 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437273 predicted 2364
2 SASI_Mm02_00437274 predicted 1147
3 SASI_Mm02_00437275 predicted 3928
4 SASI_Mm02_00437276 predicted 1092
5 SASI_Mm02_00437277 predicted 593
6 SASI_Mm02_00437278 predicted 4998
7 SASI_Mm02_00437279 predicted 3442
8 SASI_Mm02_00437280 predicted 3413
9 SASI_Mm02_00437281 predicted 1692
10 SASI_Mm02_00437282 predicted 3737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004239
VALIDATED
TRIP11 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-629s1c1
Sequence:CCGGGCAATCTACAAGTTACCGAAACTCGAGTTTCGGTAACTTGTAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-4466s1c1
Sequence:CCGGCCACAGATTGTCTGATTCGATCTCGAGATCGAATCAGACAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-4221s1c1
Sequence:CCGGGCACAAGTTCAGCACAGCATTCTCGAGAATGCTGTGCTGAACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-1788s1c1
Sequence:CCGGGCAAAGGAACAAGAACTCAATCTCGAGATTGAGTTCTTGTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-6136s1c1
Sequence:CCGGCGGCAGCTGTACCTCTTATTACTCGAGTAATAAGAGGTACAGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-6568s21c1
Sequence:CCGGCGGCAGCTGTACCTCTTATTACTCGAGTAATAAGAGGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-4898s21c1
Sequence:CCGGCCACAGATTGTCTGATTCGATCTCGAGATCGAATCAGACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-2220s21c1
Sequence:CCGGGCAAAGGAACAAGAACTCAATCTCGAGATTGAGTTCTTGTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-4653s21c1
Sequence:CCGGGCACAAGTTCAGCACAGCATTCTCGAGAATGCTGTGCTGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004239
VALIDATED
TRIP11 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-629s1c1
Sequence:CCGGGCAATCTACAAGTTACCGAAACTCGAGTTTCGGTAACTTGTAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-4466s1c1
Sequence:CCGGCCACAGATTGTCTGATTCGATCTCGAGATCGAATCAGACAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-4221s1c1
Sequence:CCGGGCACAAGTTCAGCACAGCATTCTCGAGAATGCTGTGCTGAACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-1788s1c1
Sequence:CCGGGCAAAGGAACAAGAACTCAATCTCGAGATTGAGTTCTTGTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-6136s1c1
Sequence:CCGGCGGCAGCTGTACCTCTTATTACTCGAGTAATAAGAGGTACAGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-6568s21c1
Sequence:CCGGCGGCAGCTGTACCTCTTATTACTCGAGTAATAAGAGGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-4898s21c1
Sequence:CCGGCCACAGATTGTCTGATTCGATCTCGAGATCGAATCAGACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-2220s21c1
Sequence:CCGGGCAAAGGAACAAGAACTCAATCTCGAGATTGAGTTCTTGTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-4653s21c1
Sequence:CCGGGCACAAGTTCAGCACAGCATTCTCGAGAATGCTGTGCTGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004239
VALIDATED
TRIP11 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-629s1c1
Sequence:CCGGGCAATCTACAAGTTACCGAAACTCGAGTTTCGGTAACTTGTAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-4466s1c1
Sequence:CCGGCCACAGATTGTCTGATTCGATCTCGAGATCGAATCAGACAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-4221s1c1
Sequence:CCGGGCACAAGTTCAGCACAGCATTCTCGAGAATGCTGTGCTGAACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-1788s1c1
Sequence:CCGGGCAAAGGAACAAGAACTCAATCTCGAGATTGAGTTCTTGTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004239.1-6136s1c1
Sequence:CCGGCGGCAGCTGTACCTCTTATTACTCGAGTAATAAGAGGTACAGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-6568s21c1
Sequence:CCGGCGGCAGCTGTACCTCTTATTACTCGAGTAATAAGAGGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-4898s21c1
Sequence:CCGGCCACAGATTGTCTGATTCGATCTCGAGATCGAATCAGACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-2220s21c1
Sequence:CCGGGCAAAGGAACAAGAACTCAATCTCGAGATTGAGTTCTTGTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004239.2-4653s21c1
Sequence:CCGGGCACAAGTTCAGCACAGCATTCTCGAGAATGCTGTGCTGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001001171
VALIDATED
TRIP11 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-6299s21c1
Sequence:CCGGCTGTATGTGTGTGAACTTTATCTCGAGATAAAGTTCACACACATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-3928s21c1
Sequence:CCGGCTCTTACAGGAGCGGGATAAACTCGAGTTTATCCCGCTCCTGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-3665s21c1
Sequence:CCGGATCATAAGGTGATCGATATTACTCGAGTAATATCGATCACCTTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-2584s21c1
Sequence:CCGGCTGGAACAGGAGCGCTTAATTCTCGAGAATTAAGCGCTCCTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-408s21c1
Sequence:CCGGTTCGAACTTCACGAAGGATATCTCGAGATATCCTTCGTGAAGTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001001171
VALIDATED
TRIP11 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-6299s21c1
Sequence:CCGGCTGTATGTGTGTGAACTTTATCTCGAGATAAAGTTCACACACATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-3928s21c1
Sequence:CCGGCTCTTACAGGAGCGGGATAAACTCGAGTTTATCCCGCTCCTGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-3665s21c1
Sequence:CCGGATCATAAGGTGATCGATATTACTCGAGTAATATCGATCACCTTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-2584s21c1
Sequence:CCGGCTGGAACAGGAGCGCTTAATTCTCGAGAATTAAGCGCTCCTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-408s21c1
Sequence:CCGGTTCGAACTTCACGAAGGATATCTCGAGATATCCTTCGTGAAGTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001001171
VALIDATED
TRIP11 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-6299s21c1
Sequence:CCGGCTGTATGTGTGTGAACTTTATCTCGAGATAAAGTTCACACACATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-3928s21c1
Sequence:CCGGCTCTTACAGGAGCGGGATAAACTCGAGTTTATCCCGCTCCTGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-3665s21c1
Sequence:CCGGATCATAAGGTGATCGATATTACTCGAGTAATATCGATCACCTTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-2584s21c1
Sequence:CCGGCTGGAACAGGAGCGCTTAATTCTCGAGAATTAAGCGCTCCTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_001001171.2-408s21c1
Sequence:CCGGTTCGAACTTCACGAAGGATATCTCGAGATATCCTTCGTGAAGTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks