EMAIL THIS PAGE TO A FRIEND

TRIP12

thyroid hormone receptor interactor 12

Synonyms: ULF
Gene ID:
Mouse(14897) thyroid hormone receptor interactor 12
Rat(316575) thyroid hormone receptor interactor 12
Zebrafish(564866) thyroid hormone receptor interactor 12
Horse(100056934) thyroid hormone receptor interactor 12
chicken(424785) thyroid hormone receptor interactor 12
dog(477400) thyroid hormone receptor interactor 12
domestic cat(101089286) thyroid hormone receptor interactor 12
cow(514387) thyroid hormone receptor interactor 12
sheep(101105057) thyroid hormone receptor interactor 12
domestic guinea pig(100729386) thyroid hormone receptor interactor 12
Domestic Rabbit(100341427) thyroid hormone receptor interactor 12
naked mole-rat(101720066) thyroid hormone receptor interactor 12
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004238 Rosetta Predictions human pricing
NM_001031659 Rosetta Predictions rat pricing
NM_133975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130068 predicted 4361
2 SASI_Hs02_00337169 predicted 5555
3 SASI_Hs02_00337170 predicted 5755
4 SASI_Hs01_00130071 predicted 6011
5 SASI_Hs01_00130072 predicted 5737
6 SASI_Hs02_00337171 predicted 2900
7 SASI_Hs01_00130075 predicted 2070
8 SASI_Hs01_00130076 predicted 1860
9 SASI_Hs01_00130077 predicted 1771
10 SASI_Hs02_00337172 predicted 2436
11 SASI_Hs01_00130069 predicted 5847
12 SASI_Hs01_00130070 predicted 4158
13 SASI_Hs01_00130073 predicted 418
14 SASI_Hs01_00130074 predicted 5862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203604 predicted 3938
2 SASI_Rn01_00057155 predicted 5529
3 SASI_Rn01_00057156 predicted 2133
4 SASI_Rn01_00057157 predicted 454
5 SASI_Rn01_00057158 predicted 5555
6 SASI_Rn01_00057159 predicted 3539
7 SASI_Rn01_00057160 predicted 1055
8 SASI_Rn01_00057161 predicted 392
9 SASI_Rn02_00203605 predicted 4811
10 SASI_Rn01_00057162 predicted 1825
11 SASI_Rn01_00057163 predicted 4544
12 SASI_Rn01_00057164 predicted 6011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103383 predicted 2621
2 SASI_Mm01_00103384 predicted 1895
3 SASI_Mm01_00103385 predicted 608
4 SASI_Mm02_00339098 predicted 3494
5 SASI_Mm01_00103386 predicted 4660
6 SASI_Mm01_00103387 predicted 4767
7 SASI_Mm01_00103388 predicted 1829
8 SASI_Mm01_00103389 predicted 2111
9 SASI_Mm01_00103390 predicted 3508
10 SASI_Mm01_00103391 predicted 4308
11 SASI_Mm01_00103392 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133975
TRIP12 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-5904s21c1
Sequence:CCGGCGGGCTGTGAAGTTCTTGTTTCTCGAGAAACAAGAACTTCACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133975.4-6364s21c1
Sequence:CCGGGCCCTAAAGCATTGTTGTGATCTCGAGATCACAACAATGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-4284s21c1
Sequence:CCGGCCATATAACATGACCGTGTATCTCGAGATACACGGTCATGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-5513s21c1
Sequence:CCGGGCAGGATAAATCCCAGACCAACTCGAGTTGGTCTGGGATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133975.2-3770s1c1
Sequence:CCGGGCCCTAAAGCATTGTTGTGATCTCGAGATCACAACAATGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-3310s1c1
Sequence:CCGGCGGGCTGTGAAGTTCTTGTTTCTCGAGAAACAAGAACTTCACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-1134s1c1
Sequence:CCGGGCTGTATTTGACATCTAAGAACTCGAGTTCTTAGATGTCAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-2919s1c1
Sequence:CCGGGCAGGATAAATCCCAGACCAACTCGAGTTGGTCTGGGATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-1690s1c1
Sequence:CCGGCCATATAACATGACCGTGTATCTCGAGATACACGGTCATGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133975
TRIP12 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-5904s21c1
Sequence:CCGGCGGGCTGTGAAGTTCTTGTTTCTCGAGAAACAAGAACTTCACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133975.4-6364s21c1
Sequence:CCGGGCCCTAAAGCATTGTTGTGATCTCGAGATCACAACAATGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-4284s21c1
Sequence:CCGGCCATATAACATGACCGTGTATCTCGAGATACACGGTCATGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-5513s21c1
Sequence:CCGGGCAGGATAAATCCCAGACCAACTCGAGTTGGTCTGGGATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133975.2-3770s1c1
Sequence:CCGGGCCCTAAAGCATTGTTGTGATCTCGAGATCACAACAATGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-3310s1c1
Sequence:CCGGCGGGCTGTGAAGTTCTTGTTTCTCGAGAAACAAGAACTTCACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-1134s1c1
Sequence:CCGGGCTGTATTTGACATCTAAGAACTCGAGTTCTTAGATGTCAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-2919s1c1
Sequence:CCGGGCAGGATAAATCCCAGACCAACTCGAGTTGGTCTGGGATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-1690s1c1
Sequence:CCGGCCATATAACATGACCGTGTATCTCGAGATACACGGTCATGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133975
TRIP12 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-5904s21c1
Sequence:CCGGCGGGCTGTGAAGTTCTTGTTTCTCGAGAAACAAGAACTTCACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133975.4-6364s21c1
Sequence:CCGGGCCCTAAAGCATTGTTGTGATCTCGAGATCACAACAATGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-4284s21c1
Sequence:CCGGCCATATAACATGACCGTGTATCTCGAGATACACGGTCATGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133975.4-5513s21c1
Sequence:CCGGGCAGGATAAATCCCAGACCAACTCGAGTTGGTCTGGGATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133975.2-3770s1c1
Sequence:CCGGGCCCTAAAGCATTGTTGTGATCTCGAGATCACAACAATGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-3310s1c1
Sequence:CCGGCGGGCTGTGAAGTTCTTGTTTCTCGAGAAACAAGAACTTCACAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-1134s1c1
Sequence:CCGGGCTGTATTTGACATCTAAGAACTCGAGTTCTTAGATGTCAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-2919s1c1
Sequence:CCGGGCAGGATAAATCCCAGACCAACTCGAGTTGGTCTGGGATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133975.2-1690s1c1
Sequence:CCGGCCATATAACATGACCGTGTATCTCGAGATACACGGTCATGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004238
VALIDATED
TRIP12 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-5569s21c1
Sequence:CCGGGTATCTAAGACTGGTTATATTCTCGAGAATATAACCAGTCTTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-6162s21c1
Sequence:CCGGCCTGAGTCAAGGAAACATGTTCTCGAGAACATGTTTCCTTGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-4549s21c1
Sequence:CCGGTATCAGTCGATACTGGTATTACTCGAGTAATACCAGTATCGACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-3204s21c1
Sequence:CCGGCCACTACTCAGTCACCTAAATCTCGAGATTTAGGTGACTGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-5757s21c1
Sequence:CCGGGTAGGCCTGATCATGGTTATACTCGAGTATAACCATGATCAGGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004238.1-6162s1c1
Sequence:CCGGCCTGAGTCAAGGAAACATGTTCTCGAGAACATGTTTCCTTGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004238.1-5896s1c1
Sequence:CCGGCCGGAGTTTGAATCCACCTTTCTCGAGAAAGGTGGATTCAAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-910s1c1
Sequence:CCGGCCCTAAAGTTAGCCTTCCTAACTCGAGTTAGGAAGGCTAACTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-2450s1c1
Sequence:CCGGCGGATCATTGAGCAAATCAATCTCGAGATTGATTTGCTCAATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-4169s1c1
Sequence:CCGGCCGTATAACATGACTGTGTATCTCGAGATACACAGTCATGTTATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004238
VALIDATED
TRIP12 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-5569s21c1
Sequence:CCGGGTATCTAAGACTGGTTATATTCTCGAGAATATAACCAGTCTTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-6162s21c1
Sequence:CCGGCCTGAGTCAAGGAAACATGTTCTCGAGAACATGTTTCCTTGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-4549s21c1
Sequence:CCGGTATCAGTCGATACTGGTATTACTCGAGTAATACCAGTATCGACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-3204s21c1
Sequence:CCGGCCACTACTCAGTCACCTAAATCTCGAGATTTAGGTGACTGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-5757s21c1
Sequence:CCGGGTAGGCCTGATCATGGTTATACTCGAGTATAACCATGATCAGGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004238.1-6162s1c1
Sequence:CCGGCCTGAGTCAAGGAAACATGTTCTCGAGAACATGTTTCCTTGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004238.1-5896s1c1
Sequence:CCGGCCGGAGTTTGAATCCACCTTTCTCGAGAAAGGTGGATTCAAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-910s1c1
Sequence:CCGGCCCTAAAGTTAGCCTTCCTAACTCGAGTTAGGAAGGCTAACTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-2450s1c1
Sequence:CCGGCGGATCATTGAGCAAATCAATCTCGAGATTGATTTGCTCAATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-4169s1c1
Sequence:CCGGCCGTATAACATGACTGTGTATCTCGAGATACACAGTCATGTTATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004238
VALIDATED
TRIP12 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-5569s21c1
Sequence:CCGGGTATCTAAGACTGGTTATATTCTCGAGAATATAACCAGTCTTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-6162s21c1
Sequence:CCGGCCTGAGTCAAGGAAACATGTTCTCGAGAACATGTTTCCTTGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-4549s21c1
Sequence:CCGGTATCAGTCGATACTGGTATTACTCGAGTAATACCAGTATCGACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-3204s21c1
Sequence:CCGGCCACTACTCAGTCACCTAAATCTCGAGATTTAGGTGACTGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004238.1-5757s21c1
Sequence:CCGGGTAGGCCTGATCATGGTTATACTCGAGTATAACCATGATCAGGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004238.1-6162s1c1
Sequence:CCGGCCTGAGTCAAGGAAACATGTTCTCGAGAACATGTTTCCTTGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004238.1-5896s1c1
Sequence:CCGGCCGGAGTTTGAATCCACCTTTCTCGAGAAAGGTGGATTCAAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-910s1c1
Sequence:CCGGCCCTAAAGTTAGCCTTCCTAACTCGAGTTAGGAAGGCTAACTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-2450s1c1
Sequence:CCGGCGGATCATTGAGCAAATCAATCTCGAGATTGATTTGCTCAATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004238.1-4169s1c1
Sequence:CCGGCCGTATAACATGACTGTGTATCTCGAGATACACAGTCATGTTATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks