EMAIL THIS PAGE TO A FRIEND

TRIP13

thyroid hormone receptor interactor 13

Synonyms: 16E1BP
UniProtKB ID: Q15645, C9K0T3, D3DTC0, O15324
Gene ID:
Human(9319) Summary: This gene encodes a protein that interacts with thyroid hormone receptors, also known as hormone-dependent transcription factors. The gene product interacts specifically with the ligand binding domain. This gene is one of several that may play a role in early-stage non-small cell lung cancer. [provided by RefSeq, Oct 2009]
Mouse(69716) thyroid hormone receptor interactor 13
Rat(292206) thyroid hormone receptor interactor 13
naked mole-rat(101702860) thyroid hormone receptor interactor 13
domestic guinea pig(100733277) thyroid hormone receptor interactor 13
cow(506746) thyroid hormone receptor interactor 13
sheep(101110620) thyroid hormone receptor interactor 13
Zebrafish(393554) thyroid hormone receptor interactor 13
Horse(100057897) thyroid hormone receptor interactor 13
domestic cat(101081706) thyroid hormone receptor interactor 13
dog(609426) thyroid hormone receptor interactor 13
chicken(420798) thyroid hormone receptor interactor 13
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_127444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004237 Rosetta Predictions human pricing
NM_001011930 Rosetta Predictions rat pricing
XM_574293 Rosetta Predictions rat pricing
NM_027182 Rosetta Predictions mouse pricing
XM_127444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081470 predicted 381
2 SASI_Hs01_00081472 predicted 236
3 SASI_Hs02_00337165 predicted 229
4 SASI_Hs02_00337166 predicted 228
5 SASI_Hs01_00081474 predicted 993
6 SASI_Hs01_00081476 predicted 364
7 SASI_Hs02_00337167 predicted 256
8 SASI_Hs01_00081477 predicted 684
9 SASI_Hs01_00081478 predicted 335
10 SASI_Hs02_00337168 predicted 986
11 SASI_Hs01_00081469 predicted 958
12 SASI_Hs01_00081471 predicted 810
13 SASI_Hs01_00081473 predicted 951
14 SASI_Hs01_00081475 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046718 predicted 871
2 SASI_Rn01_00046720 predicted 1117
3 SASI_Rn01_00046721 predicted 524
4 SASI_Rn01_00046722 predicted 654
5 SASI_Rn01_00046723 predicted 805
6 SASI_Rn01_00046724 predicted 777
7 SASI_Rn01_00046725 predicted 269
8 SASI_Rn01_00046726 predicted 1014
9 SASI_Rn01_00046727 predicted 681
10 SASI_Rn02_00199934 predicted 1381
11 SASI_Rn01_00046719 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194250 predicted 1562
2 SASI_Rn01_00194251 predicted 1664
3 SASI_Rn01_00194252 predicted 1814
4 SASI_Rn01_00194253 predicted 1776
5 SASI_Rn01_00194254 predicted 1671
6 SASI_Rn01_00194255 predicted 1895
7 SASI_Rn01_00194256 predicted 1484
8 SASI_Rn01_00194257 predicted 1659
9 SASI_Rn01_00194258 predicted 1658
10 SASI_Rn01_00194259 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331708 predicted 650
2 SASI_Mm02_00331709 predicted 899
3 SASI_Mm02_00331710 predicted 1198
4 SASI_Mm02_00331711 predicted 887
5 SASI_Mm02_00331712 predicted 849
6 SASI_Mm02_00331713 predicted 1462
7 SASI_Mm02_00331714 predicted 625
8 SASI_Mm02_00331715 predicted 616
9 SASI_Mm02_00331716 predicted 861
10 SASI_Mm02_00331717 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276953 predicted 917
2 SASI_Mm01_00276954 predicted 1213
3 SASI_Mm01_00276955 predicted 902
4 SASI_Mm01_00276956 predicted 875
5 SASI_Mm01_00276957 predicted 1480
6 SASI_Mm01_00276958 predicted 638
7 SASI_Mm01_00276959 predicted 636
8 SASI_Mm01_00276960 predicted 873
9 SASI_Mm01_00276961 predicted 1008
10 SASI_Mm01_00276962 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127444
TRIP13 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-432s1c1
Sequence:CCGGGACACAGAACTAAAGGCTAAACTCGAGTTTAGCCTTTAGTTCTGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-309s1c1
Sequence:CCGGGAAGATATAAAGTCGAGTGTTCTCGAGAACACTCGACTTTATATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-1458s1c1
Sequence:CCGGGACAAACAGTTTGAGGAGAAACTCGAGTTTCTCCTCAAACTGTTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-1025s1c1
Sequence:CCGGCCGAGTAGTCAATGCTGTGTTCTCGAGAACACAGCATTGACTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-671s1c1
Sequence:CCGGCGTACTCTTCTCAGACAAGAACTCGAGTTCTTGTCTGAGAAGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127444
TRIP13 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-432s1c1
Sequence:CCGGGACACAGAACTAAAGGCTAAACTCGAGTTTAGCCTTTAGTTCTGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-309s1c1
Sequence:CCGGGAAGATATAAAGTCGAGTGTTCTCGAGAACACTCGACTTTATATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-1458s1c1
Sequence:CCGGGACAAACAGTTTGAGGAGAAACTCGAGTTTCTCCTCAAACTGTTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-1025s1c1
Sequence:CCGGCCGAGTAGTCAATGCTGTGTTCTCGAGAACACAGCATTGACTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-671s1c1
Sequence:CCGGCGTACTCTTCTCAGACAAGAACTCGAGTTCTTGTCTGAGAAGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127444
TRIP13 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-432s1c1
Sequence:CCGGGACACAGAACTAAAGGCTAAACTCGAGTTTAGCCTTTAGTTCTGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-309s1c1
Sequence:CCGGGAAGATATAAAGTCGAGTGTTCTCGAGAACACTCGACTTTATATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-1458s1c1
Sequence:CCGGGACAAACAGTTTGAGGAGAAACTCGAGTTTCTCCTCAAACTGTTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-1025s1c1
Sequence:CCGGCCGAGTAGTCAATGCTGTGTTCTCGAGAACACAGCATTGACTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127444.3-671s1c1
Sequence:CCGGCGTACTCTTCTCAGACAAGAACTCGAGTTCTTGTCTGAGAAGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004237
VALIDATED
TRIP13 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-560s1c1
Sequence:CCGGCGATTATGTGATGACAACTTTCTCGAGAAAGTTGTCATCACATAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-242s1c1
Sequence:CCGGGCTACTCAACAGACATAATATCTCGAGATATTATGTCTGTTGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-388s1c1
Sequence:CCGGGCACTGTTGCACTTCACATTTCTCGAGAAATGTGAAGTGCAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004237.2-1001s1c1
Sequence:CCGGCACTTCTAACATCACCGAGAACTCGAGTTCTCGGTGATGTTAGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-1359s1c1
Sequence:CCGGGCAGTGGACAAGCAGTTTGAACTCGAGTTCAAACTGCTTGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-1159s21c1
Sequence:CCGGGATGAAGTGTCAGATCATATACTCGAGTATATGATCTGACACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-978s21c1
Sequence:CCGGATGCTGTCTTGACCCAAATTGCTCGAGCAATTTGGGTCAAGACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004237.3-1577s21c1
Sequence:CCGGACCAAGGCCAGGCTTTGTTAACTCGAGTTAACAAAGCCTGGCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-564s21c1
Sequence:CCGGTATACGATGTGGAAGTCAAATCTCGAGATTTGACTTCCACATCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-354s21c1
Sequence:CCGGTGCAGTCTGTGTCTATTATTGCTCGAGCAATAATAGACACAGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004237
VALIDATED
TRIP13 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-560s1c1
Sequence:CCGGCGATTATGTGATGACAACTTTCTCGAGAAAGTTGTCATCACATAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-242s1c1
Sequence:CCGGGCTACTCAACAGACATAATATCTCGAGATATTATGTCTGTTGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-388s1c1
Sequence:CCGGGCACTGTTGCACTTCACATTTCTCGAGAAATGTGAAGTGCAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004237.2-1001s1c1
Sequence:CCGGCACTTCTAACATCACCGAGAACTCGAGTTCTCGGTGATGTTAGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-1359s1c1
Sequence:CCGGGCAGTGGACAAGCAGTTTGAACTCGAGTTCAAACTGCTTGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-1159s21c1
Sequence:CCGGGATGAAGTGTCAGATCATATACTCGAGTATATGATCTGACACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-978s21c1
Sequence:CCGGATGCTGTCTTGACCCAAATTGCTCGAGCAATTTGGGTCAAGACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004237.3-1577s21c1
Sequence:CCGGACCAAGGCCAGGCTTTGTTAACTCGAGTTAACAAAGCCTGGCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-564s21c1
Sequence:CCGGTATACGATGTGGAAGTCAAATCTCGAGATTTGACTTCCACATCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-354s21c1
Sequence:CCGGTGCAGTCTGTGTCTATTATTGCTCGAGCAATAATAGACACAGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004237
VALIDATED
TRIP13 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-560s1c1
Sequence:CCGGCGATTATGTGATGACAACTTTCTCGAGAAAGTTGTCATCACATAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-242s1c1
Sequence:CCGGGCTACTCAACAGACATAATATCTCGAGATATTATGTCTGTTGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-388s1c1
Sequence:CCGGGCACTGTTGCACTTCACATTTCTCGAGAAATGTGAAGTGCAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004237.2-1001s1c1
Sequence:CCGGCACTTCTAACATCACCGAGAACTCGAGTTCTCGGTGATGTTAGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004237.2-1359s1c1
Sequence:CCGGGCAGTGGACAAGCAGTTTGAACTCGAGTTCAAACTGCTTGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-1159s21c1
Sequence:CCGGGATGAAGTGTCAGATCATATACTCGAGTATATGATCTGACACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-978s21c1
Sequence:CCGGATGCTGTCTTGACCCAAATTGCTCGAGCAATTTGGGTCAAGACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004237.3-1577s21c1
Sequence:CCGGACCAAGGCCAGGCTTTGTTAACTCGAGTTAACAAAGCCTGGCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-564s21c1
Sequence:CCGGTATACGATGTGGAAGTCAAATCTCGAGATTTGACTTCCACATCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004237.3-354s21c1
Sequence:CCGGTGCAGTCTGTGTCTATTATTGCTCGAGCAATAATAGACACAGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027182
TRIP13 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 13
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000319688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-292s21c1
Sequence:CCGGGAAGATATAAAGTCGAGTGTTCTCGAGAACACTCGACTTTATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-654s21c1
Sequence:CCGGCGTACTCTTCTCAGACAAGAACTCGAGTTCTTGTCTGAGAAGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-415s21c1
Sequence:CCGGGACACAGAACTAAAGGCTAAACTCGAGTTTAGCCTTTAGTTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-1441s21c1
Sequence:CCGGGACAAACAGTTTGAGGAGAAACTCGAGTTTCTCCTCAAACTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027182
TRIP13 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 13
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000319688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-292s21c1
Sequence:CCGGGAAGATATAAAGTCGAGTGTTCTCGAGAACACTCGACTTTATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-654s21c1
Sequence:CCGGCGTACTCTTCTCAGACAAGAACTCGAGTTCTTGTCTGAGAAGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-415s21c1
Sequence:CCGGGACACAGAACTAAAGGCTAAACTCGAGTTTAGCCTTTAGTTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-1441s21c1
Sequence:CCGGGACAAACAGTTTGAGGAGAAACTCGAGTTTCTCCTCAAACTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027182
TRIP13 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 13
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000319688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-292s21c1
Sequence:CCGGGAAGATATAAAGTCGAGTGTTCTCGAGAACACTCGACTTTATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-654s21c1
Sequence:CCGGCGTACTCTTCTCAGACAAGAACTCGAGTTCTTGTCTGAGAAGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-415s21c1
Sequence:CCGGGACACAGAACTAAAGGCTAAACTCGAGTTTAGCCTTTAGTTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027182.2-1441s21c1
Sequence:CCGGGACAAACAGTTTGAGGAGAAACTCGAGTTTCTCCTCAAACTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks