EMAIL THIS PAGE TO A FRIEND

TRIP4

thyroid hormone receptor interactor 4

Synonyms: ASC-1 ASC1 HsT17391
UniProtKB ID: Q15650, B2RAS0, Q96ED7, Q9UKH0
Gene ID:
Mouse(56404) thyroid hormone receptor interactor 4
Rat(315769) thyroid hormone receptor interactor 4
domestic guinea pig(100724812) thyroid hormone receptor interactor 4
naked mole-rat(101703411) thyroid hormone receptor interactor 4
Domestic Rabbit(100345449) thyroid hormone receptor interactor 4
cow(533430) thyroid hormone receptor interactor 4
sheep(678681) thyroid hormone receptor interactor 4
Zebrafish(568585) thyroid hormone receptor interactor 4
dog(478340) thyroid hormone receptor interactor 4
Horse(100053730) thyroid hormone receptor interactor 4
domestic cat(101087068) thyroid hormone receptor interactor 4
chicken(415330) thyroid hormone receptor interactor 4
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016213 Rosetta Predictions human pricing
NM_001134981 Rosetta Predictions rat pricing
XM_236360 Rosetta Predictions rat pricing
NM_019797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024567 predicted 910
2 SASI_Hs01_00024568 predicted 1265
3 SASI_Hs01_00024570 predicted 893
4 SASI_Hs01_00024571 predicted 1237
5 SASI_Hs01_00024572 predicted 780
6 SASI_Hs01_00024573 predicted 801
7 SASI_Hs01_00024574 predicted 884
8 SASI_Hs01_00024575 predicted 577
9 SASI_Hs02_00349067 predicted 726
10 SASI_Hs01_00024576 predicted 1009
11 SASI_Hs01_00024569 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259214 predicted 2061
2 SASI_Rn02_00259215 predicted 1115
3 SASI_Rn02_00259216 predicted 2547
4 SASI_Rn02_00259217 predicted 1271
5 SASI_Rn02_00259218 predicted 1687
6 SASI_Rn02_00259219 predicted 1253
7 SASI_Rn02_00259220 predicted 1801
8 SASI_Rn02_00259221 predicted 2336
9 SASI_Rn02_00259222 predicted 920
10 SASI_Rn02_00259223 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150947 predicted 1549
2 SASI_Rn01_00150948 predicted 1167
3 SASI_Rn01_00150949 predicted 615
4 SASI_Rn01_00150950 predicted 767
5 SASI_Rn01_00150951 predicted 1182
6 SASI_Rn01_00150952 predicted 752
7 SASI_Rn01_00150953 predicted 1291
8 SASI_Rn01_00150954 predicted 1823
9 SASI_Rn01_00150955 predicted 417
10 SASI_Rn01_00150956 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190354 predicted 2648
2 SASI_Mm02_00325030 predicted 1163
3 SASI_Mm01_00190355 predicted 1735
4 SASI_Mm01_00190356 predicted 1690
5 SASI_Mm01_00190357 predicted 1845
6 SASI_Mm01_00190359 predicted 1003
7 SASI_Mm02_00325031 predicted 2245
8 SASI_Mm01_00190360 predicted 1012
9 SASI_Mm01_00190362 predicted 2101
10 SASI_Mm01_00190363 predicted 1289
11 SASI_Mm01_00190358 predicted 2600
12 SASI_Mm01_00190361 predicted 1638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016213
VALIDATED
TRIP4 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1565s21c1
Sequence:CCGGCTGGGCTGTGTGGACCTAATTCTCGAGAATTAGGTCCACACAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1858s21c1
Sequence:CCGGTGGAATTGAAGTAGTAGAAACCTCGAGGTTTCTACTACTTCAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016213.3-331s21c1
Sequence:CCGGGAAATCAGGCGACCATCTAAACTCGAGTTTAGATGGTCGCCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1070s21c1
Sequence:CCGGGCAGAGTATCATAGCAGACTACTCGAGTAGTCTGCTATGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1271s21c1
Sequence:CCGGGGACTAGAGTTCAACTCATTTCTCGAGAAATGAGTTGAACTCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-788s1c1
Sequence:CCGGCCTCATCAAGAATTGCGAATTCTCGAGAATTCGCAATTCTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-1070s1c1
Sequence:CCGGGCAGAGTATCATAGCAGACTACTCGAGTAGTCTGCTATGATACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016213.2-1496s1c1
Sequence:CCGGCAGGCTACATATCGTCTTCTTCTCGAGAAGAAGACGATATGTAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016213.2-104s1c1
Sequence:CCGGCGGAAGACTTTCGGCCTGGATCTCGAGATCCAGGCCGAAAGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-1166s1c1
Sequence:CCGGCCTTTGGGAGTTCTGGTAAATCTCGAGATTTACCAGAACTCCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016213
VALIDATED
TRIP4 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1565s21c1
Sequence:CCGGCTGGGCTGTGTGGACCTAATTCTCGAGAATTAGGTCCACACAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1858s21c1
Sequence:CCGGTGGAATTGAAGTAGTAGAAACCTCGAGGTTTCTACTACTTCAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016213.3-331s21c1
Sequence:CCGGGAAATCAGGCGACCATCTAAACTCGAGTTTAGATGGTCGCCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1070s21c1
Sequence:CCGGGCAGAGTATCATAGCAGACTACTCGAGTAGTCTGCTATGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1271s21c1
Sequence:CCGGGGACTAGAGTTCAACTCATTTCTCGAGAAATGAGTTGAACTCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-788s1c1
Sequence:CCGGCCTCATCAAGAATTGCGAATTCTCGAGAATTCGCAATTCTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-1070s1c1
Sequence:CCGGGCAGAGTATCATAGCAGACTACTCGAGTAGTCTGCTATGATACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016213.2-1496s1c1
Sequence:CCGGCAGGCTACATATCGTCTTCTTCTCGAGAAGAAGACGATATGTAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016213.2-104s1c1
Sequence:CCGGCGGAAGACTTTCGGCCTGGATCTCGAGATCCAGGCCGAAAGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-1166s1c1
Sequence:CCGGCCTTTGGGAGTTCTGGTAAATCTCGAGATTTACCAGAACTCCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016213
VALIDATED
TRIP4 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1565s21c1
Sequence:CCGGCTGGGCTGTGTGGACCTAATTCTCGAGAATTAGGTCCACACAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1858s21c1
Sequence:CCGGTGGAATTGAAGTAGTAGAAACCTCGAGGTTTCTACTACTTCAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016213.3-331s21c1
Sequence:CCGGGAAATCAGGCGACCATCTAAACTCGAGTTTAGATGGTCGCCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1070s21c1
Sequence:CCGGGCAGAGTATCATAGCAGACTACTCGAGTAGTCTGCTATGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016213.3-1271s21c1
Sequence:CCGGGGACTAGAGTTCAACTCATTTCTCGAGAAATGAGTTGAACTCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-788s1c1
Sequence:CCGGCCTCATCAAGAATTGCGAATTCTCGAGAATTCGCAATTCTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-1070s1c1
Sequence:CCGGGCAGAGTATCATAGCAGACTACTCGAGTAGTCTGCTATGATACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016213.2-1496s1c1
Sequence:CCGGCAGGCTACATATCGTCTTCTTCTCGAGAAGAAGACGATATGTAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016213.2-104s1c1
Sequence:CCGGCGGAAGACTTTCGGCCTGGATCTCGAGATCCAGGCCGAAAGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016213.2-1166s1c1
Sequence:CCGGCCTTTGGGAGTTCTGGTAAATCTCGAGATTTACCAGAACTCCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019797
TRIP4 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-2318s1c1
Sequence:CCGGCGTGGGAAAGATGTGGAGTTTCTCGAGAAACTCCACATCTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-1683s1c1
Sequence:CCGGCCCAAGTTATTGACGATGAATCTCGAGATTCATCGTCAATAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-919s1c1
Sequence:CCGGCCTGGATGTCAGCGAGGAAATCTCGAGATTTCCTCGCTGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-2330s1c1
Sequence:CCGGGTGGAGTTTCCAAATGACTATCTCGAGATAGTCATTTGGAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-980s1c1
Sequence:CCGGCGAGAATATGTGACAGACCTTCTCGAGAAGGTCTGTCACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019797
TRIP4 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-2318s1c1
Sequence:CCGGCGTGGGAAAGATGTGGAGTTTCTCGAGAAACTCCACATCTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-1683s1c1
Sequence:CCGGCCCAAGTTATTGACGATGAATCTCGAGATTCATCGTCAATAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-919s1c1
Sequence:CCGGCCTGGATGTCAGCGAGGAAATCTCGAGATTTCCTCGCTGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-2330s1c1
Sequence:CCGGGTGGAGTTTCCAAATGACTATCTCGAGATAGTCATTTGGAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-980s1c1
Sequence:CCGGCGAGAATATGTGACAGACCTTCTCGAGAAGGTCTGTCACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019797
TRIP4 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-2318s1c1
Sequence:CCGGCGTGGGAAAGATGTGGAGTTTCTCGAGAAACTCCACATCTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-1683s1c1
Sequence:CCGGCCCAAGTTATTGACGATGAATCTCGAGATTCATCGTCAATAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-919s1c1
Sequence:CCGGCCTGGATGTCAGCGAGGAAATCTCGAGATTTCCTCGCTGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-2330s1c1
Sequence:CCGGGTGGAGTTTCCAAATGACTATCTCGAGATAGTCATTTGGAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019797.2-980s1c1
Sequence:CCGGCGAGAATATGTGACAGACCTTCTCGAGAAGGTCTGTCACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks