EMAIL THIS PAGE TO A FRIEND

TRIQK

triple QxxK/R motif containing

Synonyms: C8orf83 PRO0845 UPF0599
UniProtKB ID: Q629K1
Gene ID:
Mouse(208820) triple QxxK/R motif containing
Rat(500413) triple QxxK/R motif containing
domestic guinea pig(100723611) triple QxxK/R motif containing
naked mole-rat(101721003) triple QxxK/R motif containing
cow(100848801) triple QxxK/R motif containing
sheep(101113078) triple QxxK/R motif containing
Zebrafish(100147776) triple QxxK/R motif containing
domestic cat(101082040) triple QxxK/R motif containing
dog(100683423) triple QxxK/R motif containing
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001171799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001171799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001171799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047611 MISSION® esiRNA esiRNA targeting mouse AL808105.15-1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_015339 Rosetta Predictions human pricing
XM_001055066 Rosetta Predictions rat pricing
XM_575775 Rosetta Predictions rat pricing
NM_173746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381052 predicted 2633
2 SASI_Hs02_00381053 predicted 700
3 SASI_Hs02_00381054 predicted 757
4 SASI_Hs02_00381055 predicted 3006
5 SASI_Hs02_00381056 predicted 1413
6 SASI_Hs02_00381057 predicted 526
7 SASI_Hs02_00381058 predicted 2908
8 SASI_Hs02_00381059 predicted 2013
9 SASI_Hs02_00381060 predicted 428
10 SASI_Hs02_00381061 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278308 predicted 429
2 SASI_Rn02_00278309 predicted 409
3 SASI_Rn02_00278310 predicted 539
4 SASI_Rn02_00278311 predicted 847
5 SASI_Rn02_00278312 predicted 935
6 SASI_Rn02_00278313 predicted 949
7 SASI_Rn02_00278314 predicted 751
8 SASI_Rn02_00278315 predicted 935
9 SASI_Rn02_00278316 predicted 698
10 SASI_Rn02_00278317 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404303 predicted 1011
2 SASI_Rn02_00404304 predicted 544
3 SASI_Rn02_00404305 predicted 478
4 SASI_Rn02_00404306 predicted 845
5 SASI_Rn02_00404307 predicted 931
6 SASI_Rn02_00404308 predicted 943
7 SASI_Rn02_00404309 predicted 746
8 SASI_Rn02_00404310 predicted 933
9 SASI_Rn02_00404311 predicted 705
10 SASI_Rn02_00404312 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097672 predicted 1046
2 SASI_Mm01_00097673 predicted 933
3 SASI_Mm01_00097674 predicted 784
4 SASI_Mm01_00097675 predicted 818
5 SASI_Mm01_00097676 predicted 834
6 SASI_Mm01_00097677 predicted 1049
7 SASI_Mm01_00097678 predicted 1103
8 SASI_Mm01_00097679 predicted 973
9 SASI_Mm01_00097680 predicted 1146
10 SASI_Mm01_00097681 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001171799
TRIQK MISSION shRNA Bacterial Glycerol Stock
triple QxxK/R motif containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-300s21c1
Sequence:CCGGCATAAAGGAAGTTGGCCTTGTCTCGAGACAAGGCCAACTTCCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-327s21c1
Sequence:CCGGAGCTATATTGGCACTACTACTCTCGAGAGTAGTAGTGCCAATATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-417s21c1
Sequence:CCGGTTAGCTAAGCAACAATCAATGCTCGAGCATTGATTGTTGCTTAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-371s21c1
Sequence:CCGGTCAGACTCACCACGGATGTTGCTCGAGCAACATCCGTGGTGAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-338s21c1
Sequence:CCGGCACTACTACTGGCTTTCTATGCTCGAGCATAGAAAGCCAGTAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-189s21c1
Sequence:CCGGACTTCCTGTTGATCAGTACAGCTCGAGCTGTACTGATCAACAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001171799.1-703s21c1
Sequence:CCGGCAAATGTCATTGCCAATTTATCTCGAGATAAATTGGCAATGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-214s21c1
Sequence:CCGGCAAATTGGTAAACAGGATTATCTCGAGATAATCCTGTTTACCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001171799
TRIQK MISSION shRNA shRNA Plasmid DNA
triple QxxK/R motif containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-300s21c1
Sequence:CCGGCATAAAGGAAGTTGGCCTTGTCTCGAGACAAGGCCAACTTCCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-327s21c1
Sequence:CCGGAGCTATATTGGCACTACTACTCTCGAGAGTAGTAGTGCCAATATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-417s21c1
Sequence:CCGGTTAGCTAAGCAACAATCAATGCTCGAGCATTGATTGTTGCTTAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-371s21c1
Sequence:CCGGTCAGACTCACCACGGATGTTGCTCGAGCAACATCCGTGGTGAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-338s21c1
Sequence:CCGGCACTACTACTGGCTTTCTATGCTCGAGCATAGAAAGCCAGTAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-189s21c1
Sequence:CCGGACTTCCTGTTGATCAGTACAGCTCGAGCTGTACTGATCAACAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001171799.1-703s21c1
Sequence:CCGGCAAATGTCATTGCCAATTTATCTCGAGATAAATTGGCAATGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-214s21c1
Sequence:CCGGCAAATTGGTAAACAGGATTATCTCGAGATAATCCTGTTTACCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001171799
TRIQK MISSION shRNA Lentiviral Transduction Particles
triple QxxK/R motif containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-300s21c1
Sequence:CCGGCATAAAGGAAGTTGGCCTTGTCTCGAGACAAGGCCAACTTCCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-327s21c1
Sequence:CCGGAGCTATATTGGCACTACTACTCTCGAGAGTAGTAGTGCCAATATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-417s21c1
Sequence:CCGGTTAGCTAAGCAACAATCAATGCTCGAGCATTGATTGTTGCTTAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-371s21c1
Sequence:CCGGTCAGACTCACCACGGATGTTGCTCGAGCAACATCCGTGGTGAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-338s21c1
Sequence:CCGGCACTACTACTGGCTTTCTATGCTCGAGCATAGAAAGCCAGTAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-189s21c1
Sequence:CCGGACTTCCTGTTGATCAGTACAGCTCGAGCTGTACTGATCAACAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001171799.1-703s21c1
Sequence:CCGGCAAATGTCATTGCCAATTTATCTCGAGATAAATTGGCAATGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171799.1-214s21c1
Sequence:CCGGCAAATTGGTAAACAGGATTATCTCGAGATAATCCTGTTTACCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173746
TRIQK MISSION shRNA Bacterial Glycerol Stock
triple QxxK/R motif containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173746.2-932s1c1
Sequence:CCGGGAAAGCCATAGGAAATTGCTACTCGAGTAGCAATTTCCTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173746.2-1301s1c1
Sequence:CCGGGCCATTTAATTGTGCAGGGTTCTCGAGAACCCTGCACAATTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173746.2-1286s1c1
Sequence:CCGGGCAGTGTAACAATCTGCCATTCTCGAGAATGGCAGATTGTTACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173746.2-1003s1c1
Sequence:CCGGGACTATCTGCACATACAGGCACTCGAGTGCCTGTATGTGCAGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173746
TRIQK MISSION shRNA shRNA Plasmid DNA
triple QxxK/R motif containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173746.2-932s1c1
Sequence:CCGGGAAAGCCATAGGAAATTGCTACTCGAGTAGCAATTTCCTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173746.2-1301s1c1
Sequence:CCGGGCCATTTAATTGTGCAGGGTTCTCGAGAACCCTGCACAATTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173746.2-1286s1c1
Sequence:CCGGGCAGTGTAACAATCTGCCATTCTCGAGAATGGCAGATTGTTACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173746.2-1003s1c1
Sequence:CCGGGACTATCTGCACATACAGGCACTCGAGTGCCTGTATGTGCAGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173746
TRIQK MISSION shRNA Lentiviral Transduction Particles
triple QxxK/R motif containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173746.2-932s1c1
Sequence:CCGGGAAAGCCATAGGAAATTGCTACTCGAGTAGCAATTTCCTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173746.2-1301s1c1
Sequence:CCGGGCCATTTAATTGTGCAGGGTTCTCGAGAACCCTGCACAATTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173746.2-1286s1c1
Sequence:CCGGGCAGTGTAACAATCTGCCATTCTCGAGAATGGCAGATTGTTACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173746.2-1003s1c1
Sequence:CCGGGACTATCTGCACATACAGGCACTCGAGTGCCTGTATGTGCAGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks