EMAIL THIS PAGE TO A FRIEND

TRIT1

tRNA isopentenyltransferase 1

Synonyms: IPT MOD5
Gene ID:
Mouse(66966) tRNA isopentenyltransferase 1
Rat(362586) tRNA isopentenyltransferase 1
Zebrafish(553523) tRNA isopentenyltransferase 1
domestic cat(101096905) tRNA isopentenyltransferase 1
Horse(100068446) tRNA isopentenyltransferase 1
dog(475320) tRNA isopentenyltransferase 1
chicken(419678) tRNA isopentenyltransferase 1
cow(535006) tRNA isopentenyltransferase 1
sheep(101120119) tRNA isopentenyltransferase 1
naked mole-rat(101715105) tRNA isopentenyltransferase 1
Domestic Rabbit(100339655) tRNA isopentenyltransferase 1
domestic guinea pig(100719001) tRNA isopentenyltransferase 1
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017646 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072521 MISSION® esiRNA esiRNA human TRIT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017646 Rosetta Predictions human pricing
NM_001108676 Rosetta Predictions rat pricing
NM_025873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037349 predicted 1141
2 SASI_Hs01_00037351 predicted 446
3 SASI_Hs01_00037352 predicted 591
4 SASI_Hs01_00037353 predicted 237
5 SASI_Hs01_00037354 predicted 398
6 SASI_Hs01_00037355 predicted 927
7 SASI_Hs02_00350345 predicted 1411
8 SASI_Hs01_00037356 predicted 213
9 SASI_Hs01_00037358 predicted 1346
10 SASI_Hs02_00350346 predicted 911
11 SASI_Hs01_00037350 predicted 1324
12 SASI_Hs01_00037357 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240975 predicted 1234
2 SASI_Rn02_00240976 predicted 1425
3 SASI_Rn02_00240977 predicted 1296
4 SASI_Rn02_00240978 predicted 945
5 SASI_Rn02_00240979 predicted 1151
6 SASI_Rn02_00240980 predicted 357
7 SASI_Rn02_00240981 predicted 1347
8 SASI_Rn02_00240982 predicted 646
9 SASI_Rn02_00240983 predicted 1071
10 SASI_Rn02_00240984 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172789 predicted 932
2 SASI_Mm01_00172790 predicted 1257
3 SASI_Mm01_00172791 predicted 789
4 SASI_Mm01_00172792 predicted 604
5 SASI_Mm01_00172794 predicted 713
6 SASI_Mm02_00329196 predicted 204
7 SASI_Mm01_00172795 predicted 1041
8 SASI_Mm01_00172796 predicted 367
9 SASI_Mm01_00172797 predicted 795
10 SASI_Mm01_00172798 predicted 588
11 SASI_Mm01_00172793 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025873
VALIDATED
TRIT1 MISSION shRNA Bacterial Glycerol Stock
tRNA isopentenyltransferase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-927s1c1
Sequence:CCGGCAGCTTCTAAAGAAAGGTATTCTCGAGAATACCTTTCTTTAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-322s1c1
Sequence:CCGGCGGCCCTGATTGAAGATATTTCTCGAGAAATATCTTCAATCAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025873.1-1861s1c1
Sequence:CCGGGCAGAGAGATGATTAAGCAAACTCGAGTTTGCTTAATCATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-1152s1c1
Sequence:CCGGCCAGTGAAGATGGCATACAATCTCGAGATTGTATGCCATCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-926s1c1
Sequence:CCGGCCAGCTTCTAAAGAAAGGTATCTCGAGATACCTTTCTTTAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-1099s21c1
Sequence:CCGGTGCTCTCAATATAGTACAAAGCTCGAGCTTTGTACTATATTGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-843s21c1
Sequence:CCGGACGGTATCTTCCAGTCAATTGCTCGAGCAATTGACTGGAAGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-1662s21c1
Sequence:CCGGCGAGGCACAGATCGCACATTTCTCGAGAAATGTGCGATCTGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-199s21c1
Sequence:CCGGGCTAGACATCATCACCAATAACTCGAGTTATTGGTGATGATGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-719s21c1
Sequence:CCGGCTAGATGAGCGCTTGGATAAACTCGAGTTTATCCAAGCGCTCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025873.2-1717s21c1
Sequence:CCGGAGATTCAGTGCATCCTTTAAACTCGAGTTTAAAGGATGCACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025873
VALIDATED
TRIT1 MISSION shRNA shRNA Plasmid DNA
tRNA isopentenyltransferase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-927s1c1
Sequence:CCGGCAGCTTCTAAAGAAAGGTATTCTCGAGAATACCTTTCTTTAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-322s1c1
Sequence:CCGGCGGCCCTGATTGAAGATATTTCTCGAGAAATATCTTCAATCAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025873.1-1861s1c1
Sequence:CCGGGCAGAGAGATGATTAAGCAAACTCGAGTTTGCTTAATCATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-1152s1c1
Sequence:CCGGCCAGTGAAGATGGCATACAATCTCGAGATTGTATGCCATCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-926s1c1
Sequence:CCGGCCAGCTTCTAAAGAAAGGTATCTCGAGATACCTTTCTTTAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-1099s21c1
Sequence:CCGGTGCTCTCAATATAGTACAAAGCTCGAGCTTTGTACTATATTGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-843s21c1
Sequence:CCGGACGGTATCTTCCAGTCAATTGCTCGAGCAATTGACTGGAAGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-1662s21c1
Sequence:CCGGCGAGGCACAGATCGCACATTTCTCGAGAAATGTGCGATCTGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-199s21c1
Sequence:CCGGGCTAGACATCATCACCAATAACTCGAGTTATTGGTGATGATGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-719s21c1
Sequence:CCGGCTAGATGAGCGCTTGGATAAACTCGAGTTTATCCAAGCGCTCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025873.2-1717s21c1
Sequence:CCGGAGATTCAGTGCATCCTTTAAACTCGAGTTTAAAGGATGCACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025873
VALIDATED
TRIT1 MISSION shRNA Lentiviral Transduction Particles
tRNA isopentenyltransferase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-927s1c1
Sequence:CCGGCAGCTTCTAAAGAAAGGTATTCTCGAGAATACCTTTCTTTAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-322s1c1
Sequence:CCGGCGGCCCTGATTGAAGATATTTCTCGAGAAATATCTTCAATCAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025873.1-1861s1c1
Sequence:CCGGGCAGAGAGATGATTAAGCAAACTCGAGTTTGCTTAATCATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-1152s1c1
Sequence:CCGGCCAGTGAAGATGGCATACAATCTCGAGATTGTATGCCATCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025873.1-926s1c1
Sequence:CCGGCCAGCTTCTAAAGAAAGGTATCTCGAGATACCTTTCTTTAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-1099s21c1
Sequence:CCGGTGCTCTCAATATAGTACAAAGCTCGAGCTTTGTACTATATTGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-843s21c1
Sequence:CCGGACGGTATCTTCCAGTCAATTGCTCGAGCAATTGACTGGAAGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-1662s21c1
Sequence:CCGGCGAGGCACAGATCGCACATTTCTCGAGAAATGTGCGATCTGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-199s21c1
Sequence:CCGGGCTAGACATCATCACCAATAACTCGAGTTATTGGTGATGATGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025873.2-719s21c1
Sequence:CCGGCTAGATGAGCGCTTGGATAAACTCGAGTTTATCCAAGCGCTCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025873.2-1717s21c1
Sequence:CCGGAGATTCAGTGCATCCTTTAAACTCGAGTTTAAAGGATGCACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017646
VALIDATED
TRIT1 MISSION shRNA Bacterial Glycerol Stock
tRNA isopentenyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017646.3-1152s1c1
Sequence:CCGGCCAATAAAGATGCCGTACAATCTCGAGATTGTACGGCATCTTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-1321s1c1
Sequence:CCGGCCATAGAAAGTCAGAGTGTTTCTCGAGAAACACTCTGACTTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-200s1c1
Sequence:CCGGCCTAGACATCATCACCAACAACTCGAGTTGTTGGTGATGATGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017646.3-830s1c1
Sequence:CCGGCCAGGACTATCAACATGGTATCTCGAGATACCATGTTGATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-401s1c1
Sequence:CCGGGCTCTGGAAAGTTCTTGTCAACTCGAGTTGACAAGAACTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-175s21c1
Sequence:CCGGCTGACTCCATGCAGGTCTATGCTCGAGCATAGACCTGCATGGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017646.4-1751s21c1
Sequence:CCGGAGGATTGACTGCATCCCTTTACTCGAGTAAAGGGATGCAGTCAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-272s21c1
Sequence:CCGGGGATCCTCTTGTGACCAATTACTCGAGTAATTGGTCACAAGAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017646.4-1569s21c1
Sequence:CCGGAGTCTCACGTTCTCTATAATACTCGAGTATTATAGAGAACGTGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-858s21c1
Sequence:CCGGTCAATTGGCTTCAAGGAATTTCTCGAGAAATTCCTTGAAGCCAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017646
VALIDATED
TRIT1 MISSION shRNA shRNA Plasmid DNA
tRNA isopentenyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017646.3-1152s1c1
Sequence:CCGGCCAATAAAGATGCCGTACAATCTCGAGATTGTACGGCATCTTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-1321s1c1
Sequence:CCGGCCATAGAAAGTCAGAGTGTTTCTCGAGAAACACTCTGACTTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-200s1c1
Sequence:CCGGCCTAGACATCATCACCAACAACTCGAGTTGTTGGTGATGATGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017646.3-830s1c1
Sequence:CCGGCCAGGACTATCAACATGGTATCTCGAGATACCATGTTGATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-401s1c1
Sequence:CCGGGCTCTGGAAAGTTCTTGTCAACTCGAGTTGACAAGAACTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-175s21c1
Sequence:CCGGCTGACTCCATGCAGGTCTATGCTCGAGCATAGACCTGCATGGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017646.4-1751s21c1
Sequence:CCGGAGGATTGACTGCATCCCTTTACTCGAGTAAAGGGATGCAGTCAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-272s21c1
Sequence:CCGGGGATCCTCTTGTGACCAATTACTCGAGTAATTGGTCACAAGAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017646.4-1569s21c1
Sequence:CCGGAGTCTCACGTTCTCTATAATACTCGAGTATTATAGAGAACGTGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-858s21c1
Sequence:CCGGTCAATTGGCTTCAAGGAATTTCTCGAGAAATTCCTTGAAGCCAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017646
VALIDATED
TRIT1 MISSION shRNA Lentiviral Transduction Particles
tRNA isopentenyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017646.3-1152s1c1
Sequence:CCGGCCAATAAAGATGCCGTACAATCTCGAGATTGTACGGCATCTTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-1321s1c1
Sequence:CCGGCCATAGAAAGTCAGAGTGTTTCTCGAGAAACACTCTGACTTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-200s1c1
Sequence:CCGGCCTAGACATCATCACCAACAACTCGAGTTGTTGGTGATGATGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017646.3-830s1c1
Sequence:CCGGCCAGGACTATCAACATGGTATCTCGAGATACCATGTTGATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017646.3-401s1c1
Sequence:CCGGGCTCTGGAAAGTTCTTGTCAACTCGAGTTGACAAGAACTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-175s21c1
Sequence:CCGGCTGACTCCATGCAGGTCTATGCTCGAGCATAGACCTGCATGGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017646.4-1751s21c1
Sequence:CCGGAGGATTGACTGCATCCCTTTACTCGAGTAAAGGGATGCAGTCAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-272s21c1
Sequence:CCGGGGATCCTCTTGTGACCAATTACTCGAGTAATTGGTCACAAGAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017646.4-1569s21c1
Sequence:CCGGAGTCTCACGTTCTCTATAATACTCGAGTATTATAGAGAACGTGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017646.4-858s21c1
Sequence:CCGGTCAATTGGCTTCAAGGAATTTCTCGAGAAATTCCTTGAAGCCAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks