EMAIL THIS PAGE TO A FRIEND

TRMT10A

tRNA methyltransferase 10 homolog A (S. cerevisiae)

Synonyms: RG9MTD2 TRM10
UniProtKB ID: Q8TBZ6, B2R8X7, Q9Y2T9
Gene ID:
Mouse(108943) tRNA methyltransferase 10A
Rat(295496) tRNA methyltransferase 10 homolog A (S. cerevisiae)
chicken(422708) tRNA methyltransferase 10 homolog A (S. cerevisiae)
dog(487872) tRNA methyltransferase 10 homolog A (S. cerevisiae)
domestic cat(101099879) tRNA methyltransferase 10 homolog A (S. cerevisiae)
naked mole-rat(101703119) tRNA methyltransferase 10 homolog A (S. cerevisiae)
domestic guinea pig(100733117) tRNA methyltransferase 10 homolog A (S. cerevisiae)
cow(616544) RNA (guanine-9-) methyltransferase domain containing 2
sheep(101111193) tRNA methyltransferase 10 homolog A (S. cerevisiae)
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152292 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152292 Rosetta Predictions human pricing
NM_001044232 Rosetta Predictions rat pricing
NM_175389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051728 predicted 908
2 SASI_Hs01_00051729 predicted 979
3 SASI_Hs01_00051731 predicted 794
4 SASI_Hs02_00365850 predicted 1136
5 SASI_Hs01_00051732 predicted 946
6 SASI_Hs01_00051733 predicted 795
7 SASI_Hs02_00365851 predicted 1090
8 SASI_Hs01_00051734 predicted 823
9 SASI_Hs01_00051735 predicted 1160
10 SASI_Hs01_00051736 predicted 907
11 SASI_Hs01_00051730 predicted 1085
12 SASI_Hs01_00051737 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205047 predicted 461
2 SASI_Rn02_00205048 predicted 690
3 SASI_Rn02_00205049 predicted 643
4 SASI_Rn02_00205050 predicted 495
5 SASI_Rn02_00205051 predicted 729
6 SASI_Rn02_00205052 predicted 450
7 SASI_Rn02_00205053 predicted 338
8 SASI_Rn02_00205054 predicted 242
9 SASI_Rn02_00205055 predicted 785
10 SASI_Rn02_00205056 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346228 predicted 574
2 SASI_Mm02_00346229 predicted 630
3 SASI_Mm02_00346230 predicted 710
4 SASI_Mm02_00346231 predicted 635
5 SASI_Mm02_00346232 predicted 416
6 SASI_Mm02_00346233 predicted 611
7 SASI_Mm02_00346234 predicted 438
8 SASI_Mm02_00346235 predicted 389
9 SASI_Mm02_00346236 predicted 727
10 SASI_Mm02_00346237 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175389
VALIDATED
TRMT10A MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 10 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175389.2-1473s1c1
Sequence:CCGGCCCTTGAGCTTGGTTCTTTAACTCGAGTTAAAGAACCAAGCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-826s1c1
Sequence:CCGGGCAACCAGTTACGGAATCGAACTCGAGTTCGATTCCGTAACTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-187s1c1
Sequence:CCGGGCATCCATCGAGTCTCCTAATCTCGAGATTAGGAGACTCGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-370s1c1
Sequence:CCGGCGGAAGAGAAAGAAATTAGAACTCGAGTTCTAATTTCTTTCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175389.2-733s1c1
Sequence:CCGGCCTAATGTACTGAAGGACTTACTCGAGTAAGTCCTTCAGTACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-864s21c1
Sequence:CCGGAGGCATTCTTTACAATCTTACCTCGAGGTAAGATTGTAAAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-571s21c1
Sequence:CCGGCATCAAGTCAGAGCACTATAGCTCGAGCTATAGTGCTCTGACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-403s21c1
Sequence:CCGGGATGGTGTTAAAGGATATTAACTCGAGTTAATATCCTTTAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175389.4-1430s21c1
Sequence:CCGGTATTTGGTGGAGCAGATATTCCTCGAGGAATATCTGCTCCACCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-623s21c1
Sequence:CCGGCTGACGTCAGACTCACCTAATCTCGAGATTAGGTGAGTCTGACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175389
VALIDATED
TRMT10A MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 10 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175389.2-1473s1c1
Sequence:CCGGCCCTTGAGCTTGGTTCTTTAACTCGAGTTAAAGAACCAAGCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-826s1c1
Sequence:CCGGGCAACCAGTTACGGAATCGAACTCGAGTTCGATTCCGTAACTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-187s1c1
Sequence:CCGGGCATCCATCGAGTCTCCTAATCTCGAGATTAGGAGACTCGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-370s1c1
Sequence:CCGGCGGAAGAGAAAGAAATTAGAACTCGAGTTCTAATTTCTTTCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175389.2-733s1c1
Sequence:CCGGCCTAATGTACTGAAGGACTTACTCGAGTAAGTCCTTCAGTACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-864s21c1
Sequence:CCGGAGGCATTCTTTACAATCTTACCTCGAGGTAAGATTGTAAAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-571s21c1
Sequence:CCGGCATCAAGTCAGAGCACTATAGCTCGAGCTATAGTGCTCTGACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-403s21c1
Sequence:CCGGGATGGTGTTAAAGGATATTAACTCGAGTTAATATCCTTTAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175389.4-1430s21c1
Sequence:CCGGTATTTGGTGGAGCAGATATTCCTCGAGGAATATCTGCTCCACCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-623s21c1
Sequence:CCGGCTGACGTCAGACTCACCTAATCTCGAGATTAGGTGAGTCTGACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175389
VALIDATED
TRMT10A MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 10 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175389.2-1473s1c1
Sequence:CCGGCCCTTGAGCTTGGTTCTTTAACTCGAGTTAAAGAACCAAGCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-826s1c1
Sequence:CCGGGCAACCAGTTACGGAATCGAACTCGAGTTCGATTCCGTAACTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-187s1c1
Sequence:CCGGGCATCCATCGAGTCTCCTAATCTCGAGATTAGGAGACTCGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175389.2-370s1c1
Sequence:CCGGCGGAAGAGAAAGAAATTAGAACTCGAGTTCTAATTTCTTTCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175389.2-733s1c1
Sequence:CCGGCCTAATGTACTGAAGGACTTACTCGAGTAAGTCCTTCAGTACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-864s21c1
Sequence:CCGGAGGCATTCTTTACAATCTTACCTCGAGGTAAGATTGTAAAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-571s21c1
Sequence:CCGGCATCAAGTCAGAGCACTATAGCTCGAGCTATAGTGCTCTGACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-403s21c1
Sequence:CCGGGATGGTGTTAAAGGATATTAACTCGAGTTAATATCCTTTAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175389.4-1430s21c1
Sequence:CCGGTATTTGGTGGAGCAGATATTCCTCGAGGAATATCTGCTCCACCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175389.4-623s21c1
Sequence:CCGGCTGACGTCAGACTCACCTAATCTCGAGATTAGGTGAGTCTGACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152292
TRMT10A MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 10 homolog A (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-977s1c1
Sequence:CCGGGCGTCAGATTATGGAATCAATCTCGAGATTGATTCCATAATCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-917s1c1
Sequence:CCGGGCCTATGTGATTGGAGGATTACTCGAGTAATCCTCCAATCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-617s1c1
Sequence:CCGGCGCCTTATTATTGACTGTAGTCTCGAGACTACAGTCAATAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-1235s1c1
Sequence:CCGGGAGGAGGAATATAGCAGAAATCTCGAGATTTCTGCTATATTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-1052s1c1
Sequence:CCGGGCAGTTAATCATGTGTTTGAACTCGAGTTCAAACACATGATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-639s21c1
Sequence:CCGGTTGATCACTTGATGGTATTAACTCGAGTTAATACCATCAAGTGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-427s21c1
Sequence:CCGGACCAATATCTAAACGACAAATCTCGAGATTTGTCGTTTAGATATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-871s21c1
Sequence:CCGGTACGTCAGATTCACCTAATATCTCGAGATATTAGGTGAATCTGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152292
TRMT10A MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 10 homolog A (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-977s1c1
Sequence:CCGGGCGTCAGATTATGGAATCAATCTCGAGATTGATTCCATAATCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-917s1c1
Sequence:CCGGGCCTATGTGATTGGAGGATTACTCGAGTAATCCTCCAATCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-617s1c1
Sequence:CCGGCGCCTTATTATTGACTGTAGTCTCGAGACTACAGTCAATAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-1235s1c1
Sequence:CCGGGAGGAGGAATATAGCAGAAATCTCGAGATTTCTGCTATATTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-1052s1c1
Sequence:CCGGGCAGTTAATCATGTGTTTGAACTCGAGTTCAAACACATGATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-639s21c1
Sequence:CCGGTTGATCACTTGATGGTATTAACTCGAGTTAATACCATCAAGTGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-427s21c1
Sequence:CCGGACCAATATCTAAACGACAAATCTCGAGATTTGTCGTTTAGATATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-871s21c1
Sequence:CCGGTACGTCAGATTCACCTAATATCTCGAGATATTAGGTGAATCTGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152292
TRMT10A MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 10 homolog A (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-977s1c1
Sequence:CCGGGCGTCAGATTATGGAATCAATCTCGAGATTGATTCCATAATCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-917s1c1
Sequence:CCGGGCCTATGTGATTGGAGGATTACTCGAGTAATCCTCCAATCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-617s1c1
Sequence:CCGGCGCCTTATTATTGACTGTAGTCTCGAGACTACAGTCAATAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-1235s1c1
Sequence:CCGGGAGGAGGAATATAGCAGAAATCTCGAGATTTCTGCTATATTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152292.2-1052s1c1
Sequence:CCGGGCAGTTAATCATGTGTTTGAACTCGAGTTCAAACACATGATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-639s21c1
Sequence:CCGGTTGATCACTTGATGGTATTAACTCGAGTTAATACCATCAAGTGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-427s21c1
Sequence:CCGGACCAATATCTAAACGACAAATCTCGAGATTTGTCGTTTAGATATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152292.4-871s21c1
Sequence:CCGGTACGTCAGATTCACCTAATATCTCGAGATATTAGGTGAATCTGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks