EMAIL THIS PAGE TO A FRIEND

TRMT10B

tRNA methyltransferase 10 homolog B (S. cerevisiae)

Synonyms: RG9MTD3 RP11-3J10.9 bA3J10.9
UniProtKB ID: Q6PF06, Q05DJ4, Q5QP83, Q8NAG2, Q96N36
Gene ID:
Mouse(69934) tRNA methyltransferase 10B
Rat(298081) tRNA methyltransferase 10 homolog B (S. cerevisiae)
cow(516258) RNA (guanine-9-) methyltransferase domain containing 3
sheep(101106656) tRNA methyltransferase 10 homolog B (S. cerevisiae)
domestic guinea pig(100733884) tRNA methyltransferase 10 homolog B (S. cerevisiae)
naked mole-rat(101705943) tRNA methyltransferase 10 homolog B (S. cerevisiae)
dog(481615) tRNA methyltransferase 10 homolog B (S. cerevisiae)
domestic cat(101080835) tRNA methyltransferase 10 homolog B (S. cerevisiae)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41131 Anti-RG9MTD3 (AB1) antibody produced in rabbit affinity isolated antibody canine, mouse, human, rabbit, horse, rat, bovine
western blot pricing
AV41132 Anti-RG9MTD3 (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse, bovine, rat, canine, human, rabbit
western blot pricing
HPA021800 Anti-TRMT10B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702016 Anti-TRMT10B antibody produced in rabbit human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144964 Rosetta Predictions human pricing
NM_001013090 Rosetta Predictions rat pricing
NM_027266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216393 predicted 696
2 SASI_Hs01_00216394 predicted 632
3 SASI_Hs01_00216395 predicted 558
4 SASI_Hs01_00216396 predicted 812
5 SASI_Hs01_00216397 predicted 617
6 SASI_Hs01_00216398 predicted 645
7 SASI_Hs01_00216399 predicted 686
8 SASI_Hs01_00216400 predicted 712
9 SASI_Hs02_00364748 predicted 765
10 SASI_Hs02_00364749 predicted 840
11 SASI_Hs01_00216401 predicted 789
12 SASI_Hs01_00216402 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121515 predicted 814
2 SASI_Rn01_00121516 predicted 716
3 SASI_Rn01_00121517 predicted 522
4 SASI_Rn01_00121519 predicted 703
5 SASI_Rn01_00121520 predicted 861
6 SASI_Rn01_00121521 predicted 960
7 SASI_Rn01_00121523 predicted 774
8 SASI_Rn01_00121524 predicted 753
9 SASI_Rn02_00200733 predicted 248
10 SASI_Rn02_00200734 predicted 247
11 SASI_Rn01_00121518 predicted 985
12 SASI_Rn01_00121522 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121006 predicted 885
2 SASI_Mm01_00121007 predicted 795
3 SASI_Mm01_00121008 predicted 976
4 SASI_Mm01_00121009 predicted 509
5 SASI_Mm01_00121010 predicted 772
6 SASI_Mm02_00331844 predicted 265
7 SASI_Mm01_00121011 predicted 978
8 SASI_Mm01_00121012 predicted 890
9 SASI_Mm02_00331845 predicted 266
10 SASI_Mm01_00121013 predicted 615
11 SASI_Mm01_00121014 predicted 731
12 SASI_Mm01_00121015 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144964
TRMT10B MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 10 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-517s21c1
Sequence:CCGGGACAGATTCGAAGGTTGTATGCTCGAGCATACAACCTTCGAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-641s21c1
Sequence:CCGGTAGTTACCTGTTAGACATAACCTCGAGGTTATGTCTAACAGGTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-842s21c1
Sequence:CCGGACGCTTGCCAATCCAGGAATACTCGAGTATTCCTGGATTGGCAAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-666s21c1
Sequence:CCGGGAAGACTGCTTTAGTTTATTTCTCGAGAAATAAACTAAAGCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-867s1c1
Sequence:CCGGGTCAGAAACCAGAATGGGAAACTCGAGTTTCCCATTCTGGTTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-729s1c1
Sequence:CCGGGCTCTTGAAGATGTTGATCTACTCGAGTAGATCAACATCTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-464s1c1
Sequence:CCGGCGATTTGAGTATGACCCACTACTCGAGTAGTGGGTCATACTCAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-909s1c1
Sequence:CCGGGCCATCAATCAAGTGTTTGATCTCGAGATCAAACACTTGATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-408s1c1
Sequence:CCGGGCTCTAACCAAAGACAAACTTCTCGAGAAGTTTGTCTTTGGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144964
TRMT10B MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 10 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-517s21c1
Sequence:CCGGGACAGATTCGAAGGTTGTATGCTCGAGCATACAACCTTCGAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-641s21c1
Sequence:CCGGTAGTTACCTGTTAGACATAACCTCGAGGTTATGTCTAACAGGTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-842s21c1
Sequence:CCGGACGCTTGCCAATCCAGGAATACTCGAGTATTCCTGGATTGGCAAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-666s21c1
Sequence:CCGGGAAGACTGCTTTAGTTTATTTCTCGAGAAATAAACTAAAGCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-867s1c1
Sequence:CCGGGTCAGAAACCAGAATGGGAAACTCGAGTTTCCCATTCTGGTTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-729s1c1
Sequence:CCGGGCTCTTGAAGATGTTGATCTACTCGAGTAGATCAACATCTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-464s1c1
Sequence:CCGGCGATTTGAGTATGACCCACTACTCGAGTAGTGGGTCATACTCAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-909s1c1
Sequence:CCGGGCCATCAATCAAGTGTTTGATCTCGAGATCAAACACTTGATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-408s1c1
Sequence:CCGGGCTCTAACCAAAGACAAACTTCTCGAGAAGTTTGTCTTTGGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144964
TRMT10B MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 10 homolog B (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-517s21c1
Sequence:CCGGGACAGATTCGAAGGTTGTATGCTCGAGCATACAACCTTCGAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-641s21c1
Sequence:CCGGTAGTTACCTGTTAGACATAACCTCGAGGTTATGTCTAACAGGTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-842s21c1
Sequence:CCGGACGCTTGCCAATCCAGGAATACTCGAGTATTCCTGGATTGGCAAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144964.2-666s21c1
Sequence:CCGGGAAGACTGCTTTAGTTTATTTCTCGAGAAATAAACTAAAGCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-867s1c1
Sequence:CCGGGTCAGAAACCAGAATGGGAAACTCGAGTTTCCCATTCTGGTTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-729s1c1
Sequence:CCGGGCTCTTGAAGATGTTGATCTACTCGAGTAGATCAACATCTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-464s1c1
Sequence:CCGGCGATTTGAGTATGACCCACTACTCGAGTAGTGGGTCATACTCAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-909s1c1
Sequence:CCGGGCCATCAATCAAGTGTTTGATCTCGAGATCAAACACTTGATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144964.1-408s1c1
Sequence:CCGGGCTCTAACCAAAGACAAACTTCTCGAGAAGTTTGTCTTTGGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027266
VALIDATED
TRMT10B MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 10 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-391s21c1
Sequence:CCGGCCTTAACCAAAGAGAAACTTTCTCGAGAAAGTTTCTCTTTGGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-930s21c1
Sequence:CCGGGAAACTCGTAACTGGCCTGAACTCGAGTTCAGGCCAGTTACGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-892s21c1
Sequence:CCGGCCATCAACCAAGTGTTCGATACTCGAGTATCGAACACTTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-279s21c1
Sequence:CCGGGTCTCCTCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-708s21c1
Sequence:CCGGCACTCCCTTGAAGACATTGATCTCGAGATCAATGTCTTCAAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-392s1c1
Sequence:CCGGCCTTAACCAAAGAGAAACTTTCTCGAGAAAGTTTCTCTTTGGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-709s1c1
Sequence:CCGGCACTCCCTTGAAGACATTGATCTCGAGATCAATGTCTTCAAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-931s1c1
Sequence:CCGGGAAACTCGTAACTGGCCTGAACTCGAGTTCAGGCCAGTTACGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-280s1c1
Sequence:CCGGGTCTCCTCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-893s1c1
Sequence:CCGGCCATCAACCAAGTGTTCGATACTCGAGTATCGAACACTTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027266
VALIDATED
TRMT10B MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 10 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-391s21c1
Sequence:CCGGCCTTAACCAAAGAGAAACTTTCTCGAGAAAGTTTCTCTTTGGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-930s21c1
Sequence:CCGGGAAACTCGTAACTGGCCTGAACTCGAGTTCAGGCCAGTTACGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-892s21c1
Sequence:CCGGCCATCAACCAAGTGTTCGATACTCGAGTATCGAACACTTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-279s21c1
Sequence:CCGGGTCTCCTCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-708s21c1
Sequence:CCGGCACTCCCTTGAAGACATTGATCTCGAGATCAATGTCTTCAAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-392s1c1
Sequence:CCGGCCTTAACCAAAGAGAAACTTTCTCGAGAAAGTTTCTCTTTGGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-709s1c1
Sequence:CCGGCACTCCCTTGAAGACATTGATCTCGAGATCAATGTCTTCAAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-931s1c1
Sequence:CCGGGAAACTCGTAACTGGCCTGAACTCGAGTTCAGGCCAGTTACGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-280s1c1
Sequence:CCGGGTCTCCTCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-893s1c1
Sequence:CCGGCCATCAACCAAGTGTTCGATACTCGAGTATCGAACACTTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027266
VALIDATED
TRMT10B MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 10 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-391s21c1
Sequence:CCGGCCTTAACCAAAGAGAAACTTTCTCGAGAAAGTTTCTCTTTGGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-930s21c1
Sequence:CCGGGAAACTCGTAACTGGCCTGAACTCGAGTTCAGGCCAGTTACGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-892s21c1
Sequence:CCGGCCATCAACCAAGTGTTCGATACTCGAGTATCGAACACTTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-279s21c1
Sequence:CCGGGTCTCCTCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027266.4-708s21c1
Sequence:CCGGCACTCCCTTGAAGACATTGATCTCGAGATCAATGTCTTCAAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-392s1c1
Sequence:CCGGCCTTAACCAAAGAGAAACTTTCTCGAGAAAGTTTCTCTTTGGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-709s1c1
Sequence:CCGGCACTCCCTTGAAGACATTGATCTCGAGATCAATGTCTTCAAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-931s1c1
Sequence:CCGGGAAACTCGTAACTGGCCTGAACTCGAGTTCAGGCCAGTTACGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-280s1c1
Sequence:CCGGGTCTCCTCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027266.2-893s1c1
Sequence:CCGGCCATCAACCAAGTGTTCGATACTCGAGTATCGAACACTTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks