EMAIL THIS PAGE TO A FRIEND

TRMT10C

tRNA methyltransferase 10 homolog C (S. cerevisiae)

Synonyms: HNYA MRPP1 RG9MTD1
UniProtKB ID: Q7L0Y3, Q9NRG5, Q9NX54, Q9Y596
Gene ID:
Human(54931) Summary: This gene encodes the precursor of a subunit of the mitochondrial ribonuclease P, which is involved in 5' processing of mitochondrial tRNAs. The encoded protein may confer RNA-binding capacity to mitochondrial ribonuclease P and may be essential for transcript processing, RNA modification, translation and mitochondrial respiration. [provided by RefSeq, Nov 2012]
Mouse(52575) tRNA methyltransferase 10C
Rat(304012) tRNA methyltransferase 10 homolog C (S. cerevisiae)
Zebrafish(492460) tRNA methyltransferase 10 homolog C (S. cerevisiae)
dog(478545) tRNA methyltransferase 10 homolog C (S. cerevisiae)
domestic cat(101094782) tRNA methyltransferase 10 homolog C (S. cerevisiae)
chicken(418397) tRNA methyltransferase 10 homolog C (S. cerevisiae)
naked mole-rat(101720714) tRNA methyltransferase 10 homolog C (S. cerevisiae)
domestic guinea pig(100725569) tRNA methyltransferase 10 homolog C (S. cerevisiae)
cow(532418) RNA (guanine-9-) methyltransferase domain containing 1
sheep(101111763) tRNA methyltransferase 10 homolog C (S. cerevisiae)
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017819 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017819 Rosetta Predictions human pricing
NM_001008337 Rosetta Predictions rat pricing
NM_029092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197298 predicted 1138
2 SASI_Hs02_00350687 predicted 967
3 SASI_Hs01_00197301 predicted 1317
4 SASI_Hs02_00350688 predicted 211
5 SASI_Hs01_00197303 predicted 1334
6 SASI_Hs01_00197304 predicted 1018
7 SASI_Hs01_00197305 predicted 908
8 SASI_Hs01_00197306 predicted 911
9 SASI_Hs02_00350689 predicted 1297
10 SASI_Hs02_00350690 predicted 916
11 SASI_Hs01_00197299 predicted 1391
12 SASI_Hs01_00197300 predicted 905
13 SASI_Hs01_00197302 predicted 998
14 SASI_Hs01_00197307 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105993 predicted 707
2 SASI_Rn01_00105994 predicted 731
3 SASI_Rn01_00105995 predicted 1351
4 SASI_Rn01_00105996 predicted 896
5 SASI_Rn02_00199085 predicted 1012
6 SASI_Rn01_00105997 predicted 409
7 SASI_Rn01_00105998 predicted 925
8 SASI_Rn01_00105999 predicted 750
9 SASI_Rn01_00106000 predicted 772
10 SASI_Rn01_00106001 predicted 1268
11 SASI_Rn01_00106002 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114663 predicted 1077
2 SASI_Mm01_00114664 predicted 1572
3 SASI_Mm01_00114665 predicted 498
4 SASI_Mm02_00334858 predicted 910
5 SASI_Mm02_00334859 predicted 337
6 SASI_Mm01_00114667 predicted 1040
7 SASI_Mm01_00114668 predicted 1149
8 SASI_Mm01_00114669 predicted 937
9 SASI_Mm01_00114670 predicted 630
10 SASI_Mm01_00114672 predicted 353
11 SASI_Mm01_00114666 predicted 1487
12 SASI_Mm01_00114671 predicted 987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029092
TRMT10C MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 10 homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-489s1c1
Sequence:CCGGGCTACAATGAAGTCGAGCATTCTCGAGAATGCTCGACTTCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-557s1c1
Sequence:CCGGCGCCTCAACCAGAGAACTAATCTCGAGATTAGTTCTCTGGTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-684s1c1
Sequence:CCGGCGGTATCTGTATGGGAAGGAACTCGAGTTCCTTCCCATACAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-417s1c1
Sequence:CCGGGCACCTTCTTTGTCTTGTCATCTCGAGATGACAAGACAAAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-1261s1c1
Sequence:CCGGCCAAACGGTTAAACATAGCAACTCGAGTTGCTATGTTTAACCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029092
TRMT10C MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 10 homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-489s1c1
Sequence:CCGGGCTACAATGAAGTCGAGCATTCTCGAGAATGCTCGACTTCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-557s1c1
Sequence:CCGGCGCCTCAACCAGAGAACTAATCTCGAGATTAGTTCTCTGGTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-684s1c1
Sequence:CCGGCGGTATCTGTATGGGAAGGAACTCGAGTTCCTTCCCATACAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-417s1c1
Sequence:CCGGGCACCTTCTTTGTCTTGTCATCTCGAGATGACAAGACAAAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-1261s1c1
Sequence:CCGGCCAAACGGTTAAACATAGCAACTCGAGTTGCTATGTTTAACCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029092
TRMT10C MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 10 homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-489s1c1
Sequence:CCGGGCTACAATGAAGTCGAGCATTCTCGAGAATGCTCGACTTCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-557s1c1
Sequence:CCGGCGCCTCAACCAGAGAACTAATCTCGAGATTAGTTCTCTGGTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-684s1c1
Sequence:CCGGCGGTATCTGTATGGGAAGGAACTCGAGTTCCTTCCCATACAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-417s1c1
Sequence:CCGGGCACCTTCTTTGTCTTGTCATCTCGAGATGACAAGACAAAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029092.1-1261s1c1
Sequence:CCGGCCAAACGGTTAAACATAGCAACTCGAGTTGCTATGTTTAACCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017819
VALIDATED
TRMT10C MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 10 homolog C (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-1204s1c1
Sequence:CCGGCCTTAGATCAAATGATACGTACTCGAGTACGTATCATTTGATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-1268s1c1
Sequence:CCGGGCAATTCGTTCCCAAGAGAAACTCGAGTTTCTCTTGGGAACGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-918s1c1
Sequence:CCGGGAGTTAGTTAAACGGTATCAACTCGAGTTGATACCGTTTAACTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1432s21c1
Sequence:CCGGAGTAAATGCGTTAGAAATACACTCGAGTGTATTTCTAACGCATTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1410s21c1
Sequence:CCGGGAGAACATTTGATGGCTTAAACTCGAGTTTAAGCCATCAAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017819.2-1147s21c1
Sequence:CCGGTGAATGCCTTCCATTAGATAACTCGAGTTATCTAATGGAAGGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1388s21c1
Sequence:CCGGGCACAGAACACGTGGCTCAAACTCGAGTTTGAGCCACGTGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017819.2-1347s21c1
Sequence:CCGGAGGCAAAGACTTAATTCATTTCTCGAGAAATGAATTAAGTCTTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017819
VALIDATED
TRMT10C MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 10 homolog C (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-1204s1c1
Sequence:CCGGCCTTAGATCAAATGATACGTACTCGAGTACGTATCATTTGATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-1268s1c1
Sequence:CCGGGCAATTCGTTCCCAAGAGAAACTCGAGTTTCTCTTGGGAACGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-918s1c1
Sequence:CCGGGAGTTAGTTAAACGGTATCAACTCGAGTTGATACCGTTTAACTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1432s21c1
Sequence:CCGGAGTAAATGCGTTAGAAATACACTCGAGTGTATTTCTAACGCATTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1410s21c1
Sequence:CCGGGAGAACATTTGATGGCTTAAACTCGAGTTTAAGCCATCAAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017819.2-1147s21c1
Sequence:CCGGTGAATGCCTTCCATTAGATAACTCGAGTTATCTAATGGAAGGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1388s21c1
Sequence:CCGGGCACAGAACACGTGGCTCAAACTCGAGTTTGAGCCACGTGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017819.2-1347s21c1
Sequence:CCGGAGGCAAAGACTTAATTCATTTCTCGAGAAATGAATTAAGTCTTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017819
VALIDATED
TRMT10C MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 10 homolog C (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-1204s1c1
Sequence:CCGGCCTTAGATCAAATGATACGTACTCGAGTACGTATCATTTGATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-1268s1c1
Sequence:CCGGGCAATTCGTTCCCAAGAGAAACTCGAGTTTCTCTTGGGAACGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017819.1-918s1c1
Sequence:CCGGGAGTTAGTTAAACGGTATCAACTCGAGTTGATACCGTTTAACTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1432s21c1
Sequence:CCGGAGTAAATGCGTTAGAAATACACTCGAGTGTATTTCTAACGCATTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1410s21c1
Sequence:CCGGGAGAACATTTGATGGCTTAAACTCGAGTTTAAGCCATCAAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017819.2-1147s21c1
Sequence:CCGGTGAATGCCTTCCATTAGATAACTCGAGTTATCTAATGGAAGGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017819.2-1388s21c1
Sequence:CCGGGCACAGAACACGTGGCTCAAACTCGAGTTTGAGCCACGTGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017819.2-1347s21c1
Sequence:CCGGAGGCAAAGACTTAATTCATTTCTCGAGAAATGAATTAAGTCTTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks