EMAIL THIS PAGE TO A FRIEND

TRMT112

tRNA methyltransferase 11-2 homolog (S. cerevisiae)

Synonyms: HSPC152 HSPC170 TRM112 TRMT11-2
UniProtKB ID: Q9UI30, B2R539, Q3MHC7, Q8N2Z4
Gene ID:
Mouse(67674) tRNA methyltransferase 11-2
Rat(293700) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Zebrafish(553790) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
domestic cat(101100084) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
dog(476033) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
naked mole-rat(101725683) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
domestic guinea pig(100735365) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
cow(507833) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Goat(100861115) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
sheep(101103769) tRNA methyltransferase 11-2 homolog (S. cerevisiae)
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016404 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016404 Rosetta Predictions human pricing
NM_001106330 Rosetta Predictions rat pricing
XM_215167 Rosetta Predictions rat pricing
NM_026306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034520 predicted 207
2 SASI_Hs01_00034521 predicted 218
3 SASI_Hs01_00034522 predicted 201
4 SASI_Hs01_00034523 predicted 209
5 SASI_Hs01_00034524 predicted 231
6 SASI_Hs01_00034525 predicted 205
7 SASI_Hs01_00034526 predicted 208
8 SASI_Hs01_00034527 predicted 152
9 SASI_Hs01_00034528 predicted 505
10 SASI_Hs01_00034529 predicted 144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217908 predicted 207
2 SASI_Rn02_00217909 predicted 233
3 SASI_Rn02_00217910 predicted 204
4 SASI_Rn02_00217911 predicted 276
5 SASI_Rn02_00217912 predicted 280
6 SASI_Rn02_00217913 predicted 275
7 SASI_Rn02_00217914 predicted 270
8 SASI_Rn02_00217915 predicted 205
9 SASI_Rn02_00217916 predicted 312
10 SASI_Rn02_00217917 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139583 predicted 115
2 SASI_Rn01_00139584 predicted 89
3 SASI_Rn01_00139585 predicted 181
4 SASI_Rn01_00139586 predicted 299
5 SASI_Rn01_00139587 predicted 95
6 SASI_Rn01_00139588 predicted 255
7 SASI_Rn01_00139589 predicted 254
8 SASI_Rn01_00139590 predicted 346
9 SASI_Rn01_00139591 predicted 160
10 SASI_Rn01_00139592 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107772 predicted 506
2 SASI_Mm01_00107773 predicted 646
3 SASI_Mm01_00107774 predicted 639
4 SASI_Mm01_00107775 predicted 600
5 SASI_Mm01_00107776 predicted 639
6 SASI_Mm01_00107777 predicted 671
7 SASI_Mm02_00330004 predicted 401
8 SASI_Mm01_00107778 predicted 498
9 SASI_Mm01_00107779 predicted 647
10 SASI_Mm01_00107780 predicted 649
11 SASI_Mm01_00107771 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026306
VALIDATED
TRMT112 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026306.1-375s1c1
Sequence:CCGGCCAATATGCTGTTGAATGATGCTCGAGCATCATTCAACAGCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178265    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026306.2-798s1c1
Sequence:CCGGGACTGTGTGTTTCTGTTGTACCTCGAGGTACAACAGAAACACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-645s21c1
Sequence:CCGGCACGTGTTGCTTGAGGTTGATCTCGAGATCAACCTCAAGCAACACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-748s21c1
Sequence:CCGGATGAGGAGACTGAGACGTAACCTCGAGGTTACGTCTCAGTCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-772s21c1
Sequence:CCGGGCTAGCCGCCACTTTGGTATTCTCGAGAATACCAAAGTGGCGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026306.2-585s21c1
Sequence:CCGGGTACCCAAAGAGCCGACTGAACTCGAGTTCAGTCGGCTCTTTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026306.2-609s21c1
Sequence:CCGGTATGAGCACGACGAGACATTTCTCGAGAAATGTCTCGTCGTGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026306
VALIDATED
TRMT112 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026306.1-375s1c1
Sequence:CCGGCCAATATGCTGTTGAATGATGCTCGAGCATCATTCAACAGCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178265    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026306.2-798s1c1
Sequence:CCGGGACTGTGTGTTTCTGTTGTACCTCGAGGTACAACAGAAACACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-645s21c1
Sequence:CCGGCACGTGTTGCTTGAGGTTGATCTCGAGATCAACCTCAAGCAACACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-748s21c1
Sequence:CCGGATGAGGAGACTGAGACGTAACCTCGAGGTTACGTCTCAGTCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-772s21c1
Sequence:CCGGGCTAGCCGCCACTTTGGTATTCTCGAGAATACCAAAGTGGCGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026306.2-585s21c1
Sequence:CCGGGTACCCAAAGAGCCGACTGAACTCGAGTTCAGTCGGCTCTTTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026306.2-609s21c1
Sequence:CCGGTATGAGCACGACGAGACATTTCTCGAGAAATGTCTCGTCGTGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026306
VALIDATED
TRMT112 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026306.1-375s1c1
Sequence:CCGGCCAATATGCTGTTGAATGATGCTCGAGCATCATTCAACAGCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178265    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026306.2-798s1c1
Sequence:CCGGGACTGTGTGTTTCTGTTGTACCTCGAGGTACAACAGAAACACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-645s21c1
Sequence:CCGGCACGTGTTGCTTGAGGTTGATCTCGAGATCAACCTCAAGCAACACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-748s21c1
Sequence:CCGGATGAGGAGACTGAGACGTAACCTCGAGGTTACGTCTCAGTCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026306.2-772s21c1
Sequence:CCGGGCTAGCCGCCACTTTGGTATTCTCGAGAATACCAAAGTGGCGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026306.2-585s21c1
Sequence:CCGGGTACCCAAAGAGCCGACTGAACTCGAGTTCAGTCGGCTCTTTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026306.2-609s21c1
Sequence:CCGGTATGAGCACGACGAGACATTTCTCGAGAAATGTCTCGTCGTGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016404
TRMT112 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-166s1c1
Sequence:CCGGGTATGATACCTAAAGTGGAGTCTCGAGACTCCACTTTAGGTATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-164s1c1
Sequence:CCGGGCGTATGATACCTAAAGTGGACTCGAGTCCACTTTAGGTATCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-209s1c1
Sequence:CCGGCGATAACTTGCGTCTGATCCACTCGAGTGGATCAGACGCAAGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-159s1c1
Sequence:CCGGGTGGCGCGTATGATACCTAAACTCGAGTTTAGGTATCATACGCGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016404
TRMT112 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-166s1c1
Sequence:CCGGGTATGATACCTAAAGTGGAGTCTCGAGACTCCACTTTAGGTATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-164s1c1
Sequence:CCGGGCGTATGATACCTAAAGTGGACTCGAGTCCACTTTAGGTATCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-209s1c1
Sequence:CCGGCGATAACTTGCGTCTGATCCACTCGAGTGGATCAGACGCAAGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-159s1c1
Sequence:CCGGGTGGCGCGTATGATACCTAAACTCGAGTTTAGGTATCATACGCGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016404
TRMT112 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-166s1c1
Sequence:CCGGGTATGATACCTAAAGTGGAGTCTCGAGACTCCACTTTAGGTATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-164s1c1
Sequence:CCGGGCGTATGATACCTAAAGTGGACTCGAGTCCACTTTAGGTATCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-209s1c1
Sequence:CCGGCGATAACTTGCGTCTGATCCACTCGAGTGGATCAGACGCAAGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016404.1-159s1c1
Sequence:CCGGGTGGCGCGTATGATACCTAAACTCGAGTTTAGGTATCATACGCGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks