EMAIL THIS PAGE TO A FRIEND

TRMT11

tRNA methyltransferase 11 homolog (S. cerevisiae)

Synonyms: C6orf75 MDS024 TRM11 TRMT11-1
UniProtKB ID: Q7Z4G4, E1P570, Q5JY11, Q6PGQ5, Q9HC13
Gene ID:
Mouse(73681) tRNA methyltransferase 11
Rat(378794) tRNA methyltransferase 11 homolog (S. cerevisiae)
cow(514867) tRNA methyltransferase 11 homolog (S. cerevisiae)
sheep(101117511) tRNA methyltransferase 11 homolog (S. cerevisiae)
domestic guinea pig(100728385) tRNA methyltransferase 11 homolog (S. cerevisiae)
naked mole-rat(101719219) tRNA methyltransferase 11 homolog (S. cerevisiae)
Zebrafish(393185) tRNA methyltransferase 11 homolog (S. cerevisiae)
Horse(100073022) tRNA methyltransferase 11 homolog (S. cerevisiae)
domestic cat(101084627) tRNA methyltransferase 11 homolog (S. cerevisiae)
dog(476285) tRNA methyltransferase 11 homolog (S. cerevisiae)
chicken(378793) tRNA methyltransferase 11 homolog (S. cerevisiae)
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021820 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031712 Rosetta Predictions human pricing
NM_198051 Rosetta Predictions rat pricing
NM_028604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307732 predicted 1239
2 SASI_Hs01_00187637 predicted 661
3 SASI_Hs01_00187638 predicted 586
4 SASI_Hs01_00187639 predicted 799
5 SASI_Hs01_00187640 predicted 936
6 SASI_Hs01_00187641 predicted 240
7 SASI_Hs01_00187642 predicted 495
8 SASI_Hs01_00187643 predicted 1155
9 SASI_Hs01_00187644 predicted 1560
10 SASI_Hs01_00187645 predicted 1164
11 SASI_Hs01_00187636 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075895 predicted 572
2 SASI_Rn01_00075896 predicted 1061
3 SASI_Rn01_00075897 predicted 408
4 SASI_Rn01_00075898 predicted 415
5 SASI_Rn01_00075899 predicted 582
6 SASI_Rn01_00075900 predicted 209
7 SASI_Rn01_00075901 predicted 416
8 SASI_Rn01_00075902 predicted 527
9 SASI_Rn01_00075903 predicted 529
10 SASI_Rn01_00075904 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334097 predicted 198
2 SASI_Mm01_00157956 predicted 461
3 SASI_Mm01_00157957 predicted 1111
4 SASI_Mm01_00157958 predicted 612
5 SASI_Mm01_00157959 predicted 811
6 SASI_Mm01_00157960 predicted 1182
7 SASI_Mm01_00157961 predicted 627
8 SASI_Mm01_00157962 predicted 468
9 SASI_Mm01_00157963 predicted 787
10 SASI_Mm01_00157964 predicted 1378
11 SASI_Mm01_00157965 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031712
VALIDATED
TRMT11 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 11 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-509s21c1
Sequence:CCGGGCACTTGAATTTCTGCCATTTCTCGAGAAATGGCAGAAATTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1562s21c1
Sequence:CCGGGACATCTGGATGTGAACTTTCCTCGAGGAAAGTTCACATCCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1233s21c1
Sequence:CCGGTCTATTGGTTACCGGTGTATACTCGAGTATACACCGGTAACCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1422s21c1
Sequence:CCGGTGCCATACCAAGGTCATAATTCTCGAGAATTATGACCTTGGTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1145s21c1
Sequence:CCGGCCTGTTTCCTTGAGTTATCATCTCGAGATGATAACTCAAGGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031712
VALIDATED
TRMT11 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 11 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-509s21c1
Sequence:CCGGGCACTTGAATTTCTGCCATTTCTCGAGAAATGGCAGAAATTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1562s21c1
Sequence:CCGGGACATCTGGATGTGAACTTTCCTCGAGGAAAGTTCACATCCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1233s21c1
Sequence:CCGGTCTATTGGTTACCGGTGTATACTCGAGTATACACCGGTAACCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1422s21c1
Sequence:CCGGTGCCATACCAAGGTCATAATTCTCGAGAATTATGACCTTGGTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1145s21c1
Sequence:CCGGCCTGTTTCCTTGAGTTATCATCTCGAGATGATAACTCAAGGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031712
VALIDATED
TRMT11 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 11 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-509s21c1
Sequence:CCGGGCACTTGAATTTCTGCCATTTCTCGAGAAATGGCAGAAATTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1562s21c1
Sequence:CCGGGACATCTGGATGTGAACTTTCCTCGAGGAAAGTTCACATCCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1233s21c1
Sequence:CCGGTCTATTGGTTACCGGTGTATACTCGAGTATACACCGGTAACCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1422s21c1
Sequence:CCGGTGCCATACCAAGGTCATAATTCTCGAGAATTATGACCTTGGTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001031712.2-1145s21c1
Sequence:CCGGCCTGTTTCCTTGAGTTATCATCTCGAGATGATAACTCAAGGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028604
VALIDATED
TRMT11 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 11 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028604.2-1670s21c1
Sequence:CCGGAGTGTCAGGGACTGGTATATACTCGAGTATATACCAGTCCCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-476s21c1
Sequence:CCGGGCACTTGAATTTCTGCCGTTTCTCGAGAAACGGCAGAAATTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-394s21c1
Sequence:CCGGGCATTCAGATTCGACATATAACTCGAGTTATATGTCGAATCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-1061s21c1
Sequence:CCGGGACATACCAAAGGGAATAGAACTCGAGTTCTATTCCCTTTGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-1191s21c1
Sequence:CCGGTCTATTGGCTACCAGTATATACTCGAGTATATACTGGTAGCCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-418s1c1
Sequence:CCGGGCACTTGAATTTCTGCCGTTTCTCGAGAAACGGCAGAAATTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-1685s1c1
Sequence:CCGGGCCACATACATGGTAGGTAATCTCGAGATTACCTACCATGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028604.1-90s1c1
Sequence:CCGGGTTCCGCTTACCGGAAATAAACTCGAGTTTATTTCCGGTAAGCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028604.1-717s1c1
Sequence:CCGGCCTTATAGCATCTGCTCACTTCTCGAGAAGTGAGCAGATGCTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-1003s1c1
Sequence:CCGGGACATACCAAAGGGAATAGAACTCGAGTTCTATTCCCTTTGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028604
VALIDATED
TRMT11 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 11 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028604.2-1670s21c1
Sequence:CCGGAGTGTCAGGGACTGGTATATACTCGAGTATATACCAGTCCCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-476s21c1
Sequence:CCGGGCACTTGAATTTCTGCCGTTTCTCGAGAAACGGCAGAAATTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-394s21c1
Sequence:CCGGGCATTCAGATTCGACATATAACTCGAGTTATATGTCGAATCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-1061s21c1
Sequence:CCGGGACATACCAAAGGGAATAGAACTCGAGTTCTATTCCCTTTGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-1191s21c1
Sequence:CCGGTCTATTGGCTACCAGTATATACTCGAGTATATACTGGTAGCCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-418s1c1
Sequence:CCGGGCACTTGAATTTCTGCCGTTTCTCGAGAAACGGCAGAAATTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-1685s1c1
Sequence:CCGGGCCACATACATGGTAGGTAATCTCGAGATTACCTACCATGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028604.1-90s1c1
Sequence:CCGGGTTCCGCTTACCGGAAATAAACTCGAGTTTATTTCCGGTAAGCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028604.1-717s1c1
Sequence:CCGGCCTTATAGCATCTGCTCACTTCTCGAGAAGTGAGCAGATGCTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-1003s1c1
Sequence:CCGGGACATACCAAAGGGAATAGAACTCGAGTTCTATTCCCTTTGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028604
VALIDATED
TRMT11 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 11 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028604.2-1670s21c1
Sequence:CCGGAGTGTCAGGGACTGGTATATACTCGAGTATATACCAGTCCCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-476s21c1
Sequence:CCGGGCACTTGAATTTCTGCCGTTTCTCGAGAAACGGCAGAAATTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-394s21c1
Sequence:CCGGGCATTCAGATTCGACATATAACTCGAGTTATATGTCGAATCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-1061s21c1
Sequence:CCGGGACATACCAAAGGGAATAGAACTCGAGTTCTATTCCCTTTGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028604.2-1191s21c1
Sequence:CCGGTCTATTGGCTACCAGTATATACTCGAGTATATACTGGTAGCCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-418s1c1
Sequence:CCGGGCACTTGAATTTCTGCCGTTTCTCGAGAAACGGCAGAAATTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-1685s1c1
Sequence:CCGGGCCACATACATGGTAGGTAATCTCGAGATTACCTACCATGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028604.1-90s1c1
Sequence:CCGGGTTCCGCTTACCGGAAATAAACTCGAGTTTATTTCCGGTAAGCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028604.1-717s1c1
Sequence:CCGGCCTTATAGCATCTGCTCACTTCTCGAGAAGTGAGCAGATGCTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028604.1-1003s1c1
Sequence:CCGGGACATACCAAAGGGAATAGAACTCGAGTTCTATTCCCTTTGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021820
VALIDATED
TRMT11 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 11 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-539s1c1
Sequence:CCGGCCAAACTGCATCCCTGAGAATCTCGAGATTCTCAGGGATGCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021820.1-1276s1c1
Sequence:CCGGCCTGTTTCCTTGAGTTATCATCTCGAGATGATAACTCAAGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-601s1c1
Sequence:CCGGGAGAGAGCTTATTGAGTCATACTCGAGTATGACTCAATAAGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-593s1c1
Sequence:CCGGGATGGACAGAGAGAGCTTATTCTCGAGAATAAGCTCTCTCTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-751s1c1
Sequence:CCGGGCTGATAGCATGTGCTCATTTCTCGAGAAATGAGCACATGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021820.1-452s1c1
Sequence:CCGGGCACTTGAATTTCTGCCATTTCTCGAGAAATGGCAGAAATTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-133s1c1
Sequence:CCGGGCCGGAAATAAAGTCTTTGCTCTCGAGAGCAAAGACTTTATTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021820
VALIDATED
TRMT11 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 11 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-539s1c1
Sequence:CCGGCCAAACTGCATCCCTGAGAATCTCGAGATTCTCAGGGATGCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021820.1-1276s1c1
Sequence:CCGGCCTGTTTCCTTGAGTTATCATCTCGAGATGATAACTCAAGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-601s1c1
Sequence:CCGGGAGAGAGCTTATTGAGTCATACTCGAGTATGACTCAATAAGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-593s1c1
Sequence:CCGGGATGGACAGAGAGAGCTTATTCTCGAGAATAAGCTCTCTCTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-751s1c1
Sequence:CCGGGCTGATAGCATGTGCTCATTTCTCGAGAAATGAGCACATGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021820.1-452s1c1
Sequence:CCGGGCACTTGAATTTCTGCCATTTCTCGAGAAATGGCAGAAATTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-133s1c1
Sequence:CCGGGCCGGAAATAAAGTCTTTGCTCTCGAGAGCAAAGACTTTATTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021820
VALIDATED
TRMT11 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 11 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-539s1c1
Sequence:CCGGCCAAACTGCATCCCTGAGAATCTCGAGATTCTCAGGGATGCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021820.1-1276s1c1
Sequence:CCGGCCTGTTTCCTTGAGTTATCATCTCGAGATGATAACTCAAGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-601s1c1
Sequence:CCGGGAGAGAGCTTATTGAGTCATACTCGAGTATGACTCAATAAGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-593s1c1
Sequence:CCGGGATGGACAGAGAGAGCTTATTCTCGAGAATAAGCTCTCTCTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-751s1c1
Sequence:CCGGGCTGATAGCATGTGCTCATTTCTCGAGAAATGAGCACATGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021820.1-452s1c1
Sequence:CCGGGCACTTGAATTTCTGCCATTTCTCGAGAAATGGCAGAAATTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021820.1-133s1c1
Sequence:CCGGGCCGGAAATAAAGTCTTTGCTCTCGAGAGCAAAGACTTTATTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks