EMAIL THIS PAGE TO A FRIEND

TRMT12

tRNA methyltransferase 12 homolog (S. cerevisiae)

Synonyms: TRM12 TYW2
UniProtKB ID: Q53H54, Q6PKB9, Q96F21, Q9NWK6
Gene ID:
Human(55039) Summary: Wybutosine (yW) is a hypermodified guanosine at the 3-prime position adjacent to the anticodon of phenylalanine tRNA that stabilizes codon-anticodon interactions during decoding on the ribosome. TRMT12 is the human homolog of a yeast gene essential for yW synthesis (Noma and Suzuki, 2006).[supplied by OMIM, Mar 2008]
Mouse(68260) tRNA methyltranferase 12
Rat(314999) tRNA methyltransferase 12 homolog (S. cerevisiae)
chicken(422259) tRNA methyltransferase 12 homolog (S. cerevisiae)
dog(609411) tRNA methyltransferase 12 homolog (S. cerevisiae)
domestic cat(101085181) tRNA methyltransferase 12 homolog (S. cerevisiae)
Horse(100067346) tRNA methyltransferase 12 homolog (S. cerevisiae)
cow(516516) tRNA methyltransferase 12 homolog (S. cerevisiae)
sheep(101106695) tRNA methyltransferase 12 homolog (S. cerevisiae)
domestic guinea pig(100734337) tRNA methyltransferase 12 homolog (S. cerevisiae)
naked mole-rat(101715645) tRNA methyltransferase 12 homolog (S. cerevisiae)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017956 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017956 Rosetta Predictions human pricing
NM_001122976 Rosetta Predictions rat pricing
NM_026642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118416 predicted 1010
2 SASI_Hs01_00118417 predicted 1191
3 SASI_Hs02_00350989 predicted 197
4 SASI_Hs01_00118418 predicted 980
5 SASI_Hs01_00118419 predicted 472
6 SASI_Hs01_00118420 predicted 940
7 SASI_Hs01_00118421 predicted 1511
8 SASI_Hs01_00118422 predicted 1197
9 SASI_Hs01_00118423 predicted 833
10 SASI_Hs01_00118424 predicted 820
11 SASI_Hs01_00118425 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252733 predicted 684
2 SASI_Rn02_00252734 predicted 662
3 SASI_Rn02_00252735 predicted 973
4 SASI_Rn02_00252736 predicted 1392
5 SASI_Rn02_00252737 predicted 459
6 SASI_Rn02_00252738 predicted 751
7 SASI_Rn02_00252739 predicted 651
8 SASI_Rn02_00252740 predicted 1058
9 SASI_Rn02_00252741 predicted 759
10 SASI_Rn02_00252742 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330634 predicted 875
2 SASI_Mm01_00051674 predicted 1212
3 SASI_Mm01_00051675 predicted 1415
4 SASI_Mm01_00051676 predicted 1173
5 SASI_Mm01_00051677 predicted 1435
6 SASI_Mm01_00051679 predicted 674
7 SASI_Mm01_00051680 predicted 1181
8 SASI_Mm01_00051681 predicted 1172
9 SASI_Mm01_00051682 predicted 490
10 SASI_Mm01_00051683 predicted 371
11 SASI_Mm01_00051678 predicted 1456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026642
TRMT12 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 12 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026642.2-928s21c1
Sequence:CCGGAGACCGGTGCCAAATACATTTCTCGAGAAATGTATTTGGCACCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026642.2-1691s21c1
Sequence:CCGGCATTTGGTCTTGGATTTATTTCTCGAGAAATAAATCCAAGACCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026642.1-3518s1c1
Sequence:CCGGCCCTGCTTGTAACACTCCTTTCTCGAGAAAGGAGTGTTACAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-706s1c1
Sequence:CCGGCTTTGGAAACATCACCGAGAACTCGAGTTCTCGGTGATGTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-1247s1c1
Sequence:CCGGGAAACTCAGATCGCCTCTCTTCTCGAGAAGAGAGGCGATCTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-1100s1c1
Sequence:CCGGCCTGGAAGCAATAACGTGGAACTCGAGTTCCACGTTATTGCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-828s1c1
Sequence:CCGGCCTTCGTACATGCCTGTGAATCTCGAGATTCACAGGCATGTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026642
TRMT12 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 12 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026642.2-928s21c1
Sequence:CCGGAGACCGGTGCCAAATACATTTCTCGAGAAATGTATTTGGCACCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026642.2-1691s21c1
Sequence:CCGGCATTTGGTCTTGGATTTATTTCTCGAGAAATAAATCCAAGACCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026642.1-3518s1c1
Sequence:CCGGCCCTGCTTGTAACACTCCTTTCTCGAGAAAGGAGTGTTACAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-706s1c1
Sequence:CCGGCTTTGGAAACATCACCGAGAACTCGAGTTCTCGGTGATGTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-1247s1c1
Sequence:CCGGGAAACTCAGATCGCCTCTCTTCTCGAGAAGAGAGGCGATCTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-1100s1c1
Sequence:CCGGCCTGGAAGCAATAACGTGGAACTCGAGTTCCACGTTATTGCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-828s1c1
Sequence:CCGGCCTTCGTACATGCCTGTGAATCTCGAGATTCACAGGCATGTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026642
TRMT12 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 12 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026642.2-928s21c1
Sequence:CCGGAGACCGGTGCCAAATACATTTCTCGAGAAATGTATTTGGCACCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026642.2-1691s21c1
Sequence:CCGGCATTTGGTCTTGGATTTATTTCTCGAGAAATAAATCCAAGACCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026642.1-3518s1c1
Sequence:CCGGCCCTGCTTGTAACACTCCTTTCTCGAGAAAGGAGTGTTACAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-706s1c1
Sequence:CCGGCTTTGGAAACATCACCGAGAACTCGAGTTCTCGGTGATGTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-1247s1c1
Sequence:CCGGGAAACTCAGATCGCCTCTCTTCTCGAGAAGAGAGGCGATCTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-1100s1c1
Sequence:CCGGCCTGGAAGCAATAACGTGGAACTCGAGTTCCACGTTATTGCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026642.1-828s1c1
Sequence:CCGGCCTTCGTACATGCCTGTGAATCTCGAGATTCACAGGCATGTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017956
VALIDATED
TRMT12 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 12 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_017956.3-728s21c1
Sequence:CCGGGATAATGGTATCCGTTATAAGCTCGAGCTTATAACGGATACCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-1077s21c1
Sequence:CCGGCCATTGCCTGCCAAGTGTTAACTCGAGTTAACACTTGGCAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-490s21c1
Sequence:CCGGAGCCGAGTTGGAGGCTGATTTCTCGAGAAATCAGCCTCCAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-1200s21c1
Sequence:CCGGGGCTGTATCCTCAGCAAATTACTCGAGTAATTTGCTGAGGATACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017956.3-1761s21c1
Sequence:CCGGTGGCCTCGGGTTTCGTTATTTCTCGAGAAATAACGAAACCCGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-824s1c1
Sequence:CCGGGTGGATCTCTATGCAGGGATTCTCGAGAATCCCTGCATAGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017956.1-1667s1c1
Sequence:CCGGGCCCATTGAAATGAGGCTCATCTCGAGATGAGCCTCATTTCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017956.1-226s1c1
Sequence:CCGGGCAGAAACTCTTTGATACACACTCGAGTGTGTATCAAAGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-1345s1c1
Sequence:CCGGGAAACCATGGAAGACACAAATCTCGAGATTTGTGTCTTCCATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017956.1-1800s1c1
Sequence:CCGGCGTGACTATTAAGCAACTATACTCGAGTATAGTTGCTTAATAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-944s1c1
Sequence:CCGGGAGATCAATGGAGTAGCAGATCTCGAGATCTGCTACTCCATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017956
VALIDATED
TRMT12 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 12 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_017956.3-728s21c1
Sequence:CCGGGATAATGGTATCCGTTATAAGCTCGAGCTTATAACGGATACCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-1077s21c1
Sequence:CCGGCCATTGCCTGCCAAGTGTTAACTCGAGTTAACACTTGGCAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-490s21c1
Sequence:CCGGAGCCGAGTTGGAGGCTGATTTCTCGAGAAATCAGCCTCCAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-1200s21c1
Sequence:CCGGGGCTGTATCCTCAGCAAATTACTCGAGTAATTTGCTGAGGATACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017956.3-1761s21c1
Sequence:CCGGTGGCCTCGGGTTTCGTTATTTCTCGAGAAATAACGAAACCCGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-824s1c1
Sequence:CCGGGTGGATCTCTATGCAGGGATTCTCGAGAATCCCTGCATAGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017956.1-1667s1c1
Sequence:CCGGGCCCATTGAAATGAGGCTCATCTCGAGATGAGCCTCATTTCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017956.1-226s1c1
Sequence:CCGGGCAGAAACTCTTTGATACACACTCGAGTGTGTATCAAAGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-1345s1c1
Sequence:CCGGGAAACCATGGAAGACACAAATCTCGAGATTTGTGTCTTCCATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017956.1-1800s1c1
Sequence:CCGGCGTGACTATTAAGCAACTATACTCGAGTATAGTTGCTTAATAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-944s1c1
Sequence:CCGGGAGATCAATGGAGTAGCAGATCTCGAGATCTGCTACTCCATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017956
VALIDATED
TRMT12 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 12 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_017956.3-728s21c1
Sequence:CCGGGATAATGGTATCCGTTATAAGCTCGAGCTTATAACGGATACCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-1077s21c1
Sequence:CCGGCCATTGCCTGCCAAGTGTTAACTCGAGTTAACACTTGGCAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-490s21c1
Sequence:CCGGAGCCGAGTTGGAGGCTGATTTCTCGAGAAATCAGCCTCCAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017956.3-1200s21c1
Sequence:CCGGGGCTGTATCCTCAGCAAATTACTCGAGTAATTTGCTGAGGATACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017956.3-1761s21c1
Sequence:CCGGTGGCCTCGGGTTTCGTTATTTCTCGAGAAATAACGAAACCCGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-824s1c1
Sequence:CCGGGTGGATCTCTATGCAGGGATTCTCGAGAATCCCTGCATAGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017956.1-1667s1c1
Sequence:CCGGGCCCATTGAAATGAGGCTCATCTCGAGATGAGCCTCATTTCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017956.1-226s1c1
Sequence:CCGGGCAGAAACTCTTTGATACACACTCGAGTGTGTATCAAAGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-1345s1c1
Sequence:CCGGGAAACCATGGAAGACACAAATCTCGAGATTTGTGTCTTCCATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017956.1-1800s1c1
Sequence:CCGGCGTGACTATTAAGCAACTATACTCGAGTATAGTTGCTTAATAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017956.1-944s1c1
Sequence:CCGGGAGATCAATGGAGTAGCAGATCTCGAGATCTGCTACTCCATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks