EMAIL THIS PAGE TO A FRIEND

TRMT13

tRNA methyltransferase 13 homolog (S. cerevisiae)

Synonyms: CCDC76
UniProtKB ID: Q9NUP7, Q5VVL0, Q9NW65
Gene ID:
Mouse(229780) tRNA methyltransferase 13
Rat(499697) tRNA methyltransferase 13 homolog (S. cerevisiae)
naked mole-rat(101721354) tRNA methyltransferase 13 homolog (S. cerevisiae)
domestic guinea pig(100730968) tRNA methyltransferase 13 homolog (S. cerevisiae)
sheep(101112862) tRNA methyltransferase 13 homolog (S. cerevisiae)
Zebrafish(541496) tRNA methyltransferase 13 homolog (S. cerevisiae)
dog(479930) tRNA methyltransferase 13 homolog (S. cerevisiae)
domestic cat(101086829) tRNA methyltransferase 13 homolog (S. cerevisiae)
chicken(424470) tRNA methyltransferase 13 homolog (S. cerevisiae)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019083 Rosetta Predictions human pricing
NM_001033902 Rosetta Predictions rat pricing
XM_001073185 Rosetta Predictions rat pricing
XM_001077253 Rosetta Predictions rat pricing
NM_030016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119537 predicted 791
2 SASI_Hs01_00119538 predicted 1016
3 SASI_Hs01_00119539 predicted 406
4 SASI_Hs01_00119540 predicted 544
5 SASI_Hs02_00352682 predicted 1156
6 SASI_Hs01_00119541 predicted 312
7 SASI_Hs01_00119542 predicted 1027
8 SASI_Hs01_00119543 predicted 710
9 SASI_Hs01_00119544 predicted 432
10 SASI_Hs01_00119545 predicted 882
11 SASI_Hs01_00119546 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203809 predicted 710
2 SASI_Rn02_00203810 predicted 453
3 SASI_Rn02_00203811 predicted 1299
4 SASI_Rn02_00203812 predicted 438
5 SASI_Rn02_00203813 predicted 733
6 SASI_Rn02_00203814 predicted 679
7 SASI_Rn02_00203815 predicted 304
8 SASI_Rn02_00203816 predicted 500
9 SASI_Rn02_00203817 predicted 1311
10 SASI_Rn02_00203818 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341844 predicted 714
2 SASI_Rn02_00341845 predicted 450
3 SASI_Rn02_00341846 predicted 1296
4 SASI_Rn02_00341847 predicted 440
5 SASI_Rn02_00341848 predicted 724
6 SASI_Rn02_00341849 predicted 676
7 SASI_Rn02_00341850 predicted 307
8 SASI_Rn02_00341851 predicted 500
9 SASI_Rn02_00341852 predicted 1310
10 SASI_Rn02_00341853 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356403 predicted 262
2 SASI_Rn02_00356404 predicted 274
3 SASI_Rn02_00356405 predicted 262
4 SASI_Rn02_00356406 predicted 246
5 SASI_Rn02_00356407 predicted 255
6 SASI_Rn02_00356408 predicted 259
7 SASI_Rn02_00356409 predicted 249
8 SASI_Rn02_00356410 predicted 252
9 SASI_Rn02_00356411 predicted 269
10 SASI_Rn02_00356412 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336377 predicted 1905
2 SASI_Mm02_00336378 predicted 1896
3 SASI_Mm02_00336379 predicted 1680
4 SASI_Mm02_00336380 predicted 2137
5 SASI_Mm02_00336381 predicted 2180
6 SASI_Mm02_00336382 predicted 2295
7 SASI_Mm02_00336383 predicted 2278
8 SASI_Mm02_00336384 predicted 2334
9 SASI_Mm02_00336385 predicted 1833
10 SASI_Mm02_00336386 predicted 2107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019083
TRMT13 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 13 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-319s1c1
Sequence:CCGGCCTGAACAATTAGTTCCAATTCTCGAGAATTGGAACTAATTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-1314s1c1
Sequence:CCGGCCAAGGTCGAATCCAGTATTTCTCGAGAAATACTGGATTCGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-893s1c1
Sequence:CCGGCCAAACGCATAAAGAATGATACTCGAGTATCATTCTTTATGCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-992s1c1
Sequence:CCGGGCATTGTTATTGCACTCTGTTCTCGAGAACAGAGTGCAATAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-439s1c1
Sequence:CCGGCCAGCATTACACGATGCACTTCTCGAGAAGTGCATCGTGTAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-1365s21c1
Sequence:CCGGGTCCTGCTTTGCAGTACTATACTCGAGTATAGTACTGCAAAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-836s21c1
Sequence:CCGGGATCTTGCATTACGATGTTTGCTCGAGCAAACATCGTAATGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-66s21c1
Sequence:CCGGAGGGTAGATGCGGTTACTATGCTCGAGCATAGTAACCGCATCTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019083.2-1763s21c1
Sequence:CCGGCAACACATAATTAGCGTATTTCTCGAGAAATACGCTAATTATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-1240s21c1
Sequence:CCGGCACAGATGATGGCGCTGATTGCTCGAGCAATCAGCGCCATCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019083.2-1850s21c1
Sequence:CCGGTCAAGAGGTAGTGATTGATTGCTCGAGCAATCAATCACTACCTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-898s21c1
Sequence:CCGGACCTTTAGCCAAACGCATAAACTCGAGTTTATGCGTTTGGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-604s21c1
Sequence:CCGGATTATCTCATTGGGTTGATATCTCGAGATATCAACCCAATGAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019083
TRMT13 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 13 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-319s1c1
Sequence:CCGGCCTGAACAATTAGTTCCAATTCTCGAGAATTGGAACTAATTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-1314s1c1
Sequence:CCGGCCAAGGTCGAATCCAGTATTTCTCGAGAAATACTGGATTCGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-893s1c1
Sequence:CCGGCCAAACGCATAAAGAATGATACTCGAGTATCATTCTTTATGCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-992s1c1
Sequence:CCGGGCATTGTTATTGCACTCTGTTCTCGAGAACAGAGTGCAATAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-439s1c1
Sequence:CCGGCCAGCATTACACGATGCACTTCTCGAGAAGTGCATCGTGTAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-1365s21c1
Sequence:CCGGGTCCTGCTTTGCAGTACTATACTCGAGTATAGTACTGCAAAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-836s21c1
Sequence:CCGGGATCTTGCATTACGATGTTTGCTCGAGCAAACATCGTAATGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-66s21c1
Sequence:CCGGAGGGTAGATGCGGTTACTATGCTCGAGCATAGTAACCGCATCTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019083.2-1763s21c1
Sequence:CCGGCAACACATAATTAGCGTATTTCTCGAGAAATACGCTAATTATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-1240s21c1
Sequence:CCGGCACAGATGATGGCGCTGATTGCTCGAGCAATCAGCGCCATCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019083.2-1850s21c1
Sequence:CCGGTCAAGAGGTAGTGATTGATTGCTCGAGCAATCAATCACTACCTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-898s21c1
Sequence:CCGGACCTTTAGCCAAACGCATAAACTCGAGTTTATGCGTTTGGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-604s21c1
Sequence:CCGGATTATCTCATTGGGTTGATATCTCGAGATATCAACCCAATGAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019083
TRMT13 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 13 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-319s1c1
Sequence:CCGGCCTGAACAATTAGTTCCAATTCTCGAGAATTGGAACTAATTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-1314s1c1
Sequence:CCGGCCAAGGTCGAATCCAGTATTTCTCGAGAAATACTGGATTCGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-893s1c1
Sequence:CCGGCCAAACGCATAAAGAATGATACTCGAGTATCATTCTTTATGCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-992s1c1
Sequence:CCGGGCATTGTTATTGCACTCTGTTCTCGAGAACAGAGTGCAATAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019083.1-439s1c1
Sequence:CCGGCCAGCATTACACGATGCACTTCTCGAGAAGTGCATCGTGTAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-1365s21c1
Sequence:CCGGGTCCTGCTTTGCAGTACTATACTCGAGTATAGTACTGCAAAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-836s21c1
Sequence:CCGGGATCTTGCATTACGATGTTTGCTCGAGCAAACATCGTAATGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-66s21c1
Sequence:CCGGAGGGTAGATGCGGTTACTATGCTCGAGCATAGTAACCGCATCTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019083.2-1763s21c1
Sequence:CCGGCAACACATAATTAGCGTATTTCTCGAGAAATACGCTAATTATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-1240s21c1
Sequence:CCGGCACAGATGATGGCGCTGATTGCTCGAGCAATCAGCGCCATCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019083.2-1850s21c1
Sequence:CCGGTCAAGAGGTAGTGATTGATTGCTCGAGCAATCAATCACTACCTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-898s21c1
Sequence:CCGGACCTTTAGCCAAACGCATAAACTCGAGTTTATGCGTTTGGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019083.2-604s21c1
Sequence:CCGGATTATCTCATTGGGTTGATATCTCGAGATATCAACCCAATGAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030016
VALIDATED
TRMT13 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 13 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030016.2-2222s21c1
Sequence:CCGGATTATCTCACTGGGTTGATATCTCGAGATATCAACCCAGTGAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2446s21c1
Sequence:CCGGTGGCGACAGATGTTGCATTACCTCGAGGTAATGCAACATCTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-1987s21c1
Sequence:CCGGAGCAGTTGGAGAACTTAATTACTCGAGTAATTAAGTTCTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2104s21c1
Sequence:CCGGATGGCGATTGTGCAGTCAAACCTCGAGGTTTGACTGCACAATCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2074s21c1
Sequence:CCGGCATTGCATGATGCCCTTAATGCTCGAGCATTAAGGGCATCATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030016
VALIDATED
TRMT13 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 13 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030016.2-2222s21c1
Sequence:CCGGATTATCTCACTGGGTTGATATCTCGAGATATCAACCCAGTGAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2446s21c1
Sequence:CCGGTGGCGACAGATGTTGCATTACCTCGAGGTAATGCAACATCTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-1987s21c1
Sequence:CCGGAGCAGTTGGAGAACTTAATTACTCGAGTAATTAAGTTCTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2104s21c1
Sequence:CCGGATGGCGATTGTGCAGTCAAACCTCGAGGTTTGACTGCACAATCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2074s21c1
Sequence:CCGGCATTGCATGATGCCCTTAATGCTCGAGCATTAAGGGCATCATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030016
VALIDATED
TRMT13 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 13 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030016.2-2222s21c1
Sequence:CCGGATTATCTCACTGGGTTGATATCTCGAGATATCAACCCAGTGAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2446s21c1
Sequence:CCGGTGGCGACAGATGTTGCATTACCTCGAGGTAATGCAACATCTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-1987s21c1
Sequence:CCGGAGCAGTTGGAGAACTTAATTACTCGAGTAATTAAGTTCTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2104s21c1
Sequence:CCGGATGGCGATTGTGCAGTCAAACCTCGAGGTTTGACTGCACAATCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030016.2-2074s21c1
Sequence:CCGGCATTGCATGATGCCCTTAATGCTCGAGCATTAAGGGCATCATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks