EMAIL THIS PAGE TO A FRIEND

TRMT1

tRNA methyltransferase 1 homolog (S. cerevisiae)

Synonyms: TRM1
UniProtKB ID: Q9NXH9, O76103, Q548Y5, Q8WVA6
Gene ID:
Mouse(212528) tRNA methyltransferase 1
Rat(288914) tRNA methyltransferase 1 homolog (S. cerevisiae)
cow(539613) TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae)
sheep(101121680) tRNA methyltransferase 1 homolog (S. cerevisiae)
domestic guinea pig(100713363) tRNA methyltransferase 1 homolog (S. cerevisiae)
Domestic Rabbit(100350974) tRNA methyltransferase 1 homolog (S. cerevisiae)
naked mole-rat(101723979) tRNA methyltransferase 1 homolog (S. cerevisiae)
Zebrafish(553298) tRNA methyltransferase 1 homolog (S. cerevisiae)
domestic cat(101094328) tRNA methyltransferase 1 homolog (S. cerevisiae)
Horse(100146178) tRNA methyltransferase 1 homolog (S. cerevisiae)
dog(476692) tRNA methyltransferase 1 homolog (S. cerevisiae)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017722 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017722 Rosetta Predictions human pricing
NM_001013870 Rosetta Predictions rat pricing
NM_198020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350494 predicted 434
2 SASI_Hs01_00169293 predicted 364
3 SASI_Hs01_00169294 predicted 1753
4 SASI_Hs01_00169295 predicted 790
5 SASI_Hs01_00169296 predicted 642
6 SASI_Hs01_00169297 predicted 833
7 SASI_Hs01_00169298 predicted 1181
8 SASI_Hs01_00169299 predicted 1120
9 SASI_Hs01_00169300 predicted 696
10 SASI_Hs01_00169301 predicted 1625
11 SASI_Hs01_00169302 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062123 predicted 606
2 SASI_Rn01_00062125 predicted 345
3 SASI_Rn01_00062126 predicted 936
4 SASI_Rn02_00201139 predicted 271
5 SASI_Rn01_00062127 predicted 1297
6 SASI_Rn01_00062128 predicted 695
7 SASI_Rn01_00062129 predicted 973
8 SASI_Rn01_00062130 predicted 956
9 SASI_Rn02_00201140 predicted 874
10 SASI_Rn01_00062131 predicted 1093
11 SASI_Rn01_00062124 predicted 259
12 SASI_Rn01_00062132 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034088 predicted 919
2 SASI_Mm01_00034089 predicted 1519
3 SASI_Mm02_00350732 predicted 1404
4 SASI_Mm01_00034090 predicted 1032
5 SASI_Mm01_00034091 predicted 1060
6 SASI_Mm01_00034092 predicted 1066
7 SASI_Mm01_00034093 predicted 1388
8 SASI_Mm01_00034094 predicted 386
9 SASI_Mm01_00034096 predicted 1223
10 SASI_Mm01_00034097 predicted 1645
11 SASI_Mm01_00034095 predicted 1527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017722
TRMT1 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 1 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-779s21c1
Sequence:CCGGCTCAGATCTGTGGTTGCAAACCTCGAGGTTTGCAACCACAGATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-507s21c1
Sequence:CCGGGTGCTGTGATCACCGAGTTTGCTCGAGCAAACTCGGTGATCACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-819s21c1
Sequence:CCGGTGGATCTCATACGCCGGAATGCTCGAGCATTCCGGCGTATGAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-629s21c1
Sequence:CCGGGTTGAACTGAAAGAGAGTGAACTCGAGTTCACTCTCTTTCAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-1690s21c1
Sequence:CCGGCGCCTGTAAGAACGCTGTGAACTCGAGTTCACAGCGTTCTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-740s21c1
Sequence:CCGGGGCCTACGTTCCATTCGATTTCTCGAGAAATCGAATGGAACGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1071s1c1
Sequence:CCGGGCTGACTTCTACGTGCGTGTTCTCGAGAACACGCACGTAGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1626s1c1
Sequence:CCGGGAGAAGGAATGTCCGGTGAAACTCGAGTTTCACCGGACATTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-498s1c1
Sequence:CCGGGTTGAACTGAAAGAGAGTGAACTCGAGTTCACTCTCTTTCAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1919s1c1
Sequence:CCGGGCTCAAGACATTTCCTTGCAACTCGAGTTGCAAGGAAATGTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1559s1c1
Sequence:CCGGCGCCTGTAAGAACGCTGTGAACTCGAGTTCACAGCGTTCTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017722
TRMT1 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 1 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-779s21c1
Sequence:CCGGCTCAGATCTGTGGTTGCAAACCTCGAGGTTTGCAACCACAGATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-507s21c1
Sequence:CCGGGTGCTGTGATCACCGAGTTTGCTCGAGCAAACTCGGTGATCACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-819s21c1
Sequence:CCGGTGGATCTCATACGCCGGAATGCTCGAGCATTCCGGCGTATGAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-629s21c1
Sequence:CCGGGTTGAACTGAAAGAGAGTGAACTCGAGTTCACTCTCTTTCAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-1690s21c1
Sequence:CCGGCGCCTGTAAGAACGCTGTGAACTCGAGTTCACAGCGTTCTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-740s21c1
Sequence:CCGGGGCCTACGTTCCATTCGATTTCTCGAGAAATCGAATGGAACGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1071s1c1
Sequence:CCGGGCTGACTTCTACGTGCGTGTTCTCGAGAACACGCACGTAGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1626s1c1
Sequence:CCGGGAGAAGGAATGTCCGGTGAAACTCGAGTTTCACCGGACATTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-498s1c1
Sequence:CCGGGTTGAACTGAAAGAGAGTGAACTCGAGTTCACTCTCTTTCAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1919s1c1
Sequence:CCGGGCTCAAGACATTTCCTTGCAACTCGAGTTGCAAGGAAATGTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1559s1c1
Sequence:CCGGCGCCTGTAAGAACGCTGTGAACTCGAGTTCACAGCGTTCTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017722
TRMT1 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 1 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-779s21c1
Sequence:CCGGCTCAGATCTGTGGTTGCAAACCTCGAGGTTTGCAACCACAGATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-507s21c1
Sequence:CCGGGTGCTGTGATCACCGAGTTTGCTCGAGCAAACTCGGTGATCACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-819s21c1
Sequence:CCGGTGGATCTCATACGCCGGAATGCTCGAGCATTCCGGCGTATGAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-629s21c1
Sequence:CCGGGTTGAACTGAAAGAGAGTGAACTCGAGTTCACTCTCTTTCAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-1690s21c1
Sequence:CCGGCGCCTGTAAGAACGCTGTGAACTCGAGTTCACAGCGTTCTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017722.3-740s21c1
Sequence:CCGGGGCCTACGTTCCATTCGATTTCTCGAGAAATCGAATGGAACGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1071s1c1
Sequence:CCGGGCTGACTTCTACGTGCGTGTTCTCGAGAACACGCACGTAGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1626s1c1
Sequence:CCGGGAGAAGGAATGTCCGGTGAAACTCGAGTTTCACCGGACATTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-498s1c1
Sequence:CCGGGTTGAACTGAAAGAGAGTGAACTCGAGTTCACTCTCTTTCAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1919s1c1
Sequence:CCGGGCTCAAGACATTTCCTTGCAACTCGAGTTGCAAGGAAATGTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017722.2-1559s1c1
Sequence:CCGGCGCCTGTAAGAACGCTGTGAACTCGAGTTCACAGCGTTCTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198020
TRMT1 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1072s21c1
Sequence:CCGGACTTCTATATCCGGGTCTTTGCTCGAGCAAAGACCCGGATATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1927s21c1
Sequence:CCGGTTCCTTGCAAACGATTCAAAGCTCGAGCTTTGAATCGTTTGCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-684s1c1
Sequence:CCGGGTAGAGCTTATGCACAGAAATCTCGAGATTTCTGTGCATAAGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1061s1c1
Sequence:CCGGCATCAGTGCTGACTTCTATATCTCGAGATATAGAAGTCAGCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1403s21c1
Sequence:CCGGAGGCGTCCTCAGTGTTGTTACCTCGAGGTAACAACACTGAGGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-684s21c1
Sequence:CCGGGTAGAGCTTATGCACAGAAATCTCGAGATTTCTGTGCATAAGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1917s1c1
Sequence:CCGGCTTAAGACATTTCCTTGCAAACTCGAGTTTGCAAGGAAATGTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1933s1c1
Sequence:CCGGGCAAACGATTCAAAGAGGGTACTCGAGTACCCTCTTTGAATCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1655s1c1
Sequence:CCGGGTCTGAAAGCAGTCCAGCATTCTCGAGAATGCTGGACTGCTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198020
TRMT1 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1072s21c1
Sequence:CCGGACTTCTATATCCGGGTCTTTGCTCGAGCAAAGACCCGGATATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1927s21c1
Sequence:CCGGTTCCTTGCAAACGATTCAAAGCTCGAGCTTTGAATCGTTTGCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-684s1c1
Sequence:CCGGGTAGAGCTTATGCACAGAAATCTCGAGATTTCTGTGCATAAGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1061s1c1
Sequence:CCGGCATCAGTGCTGACTTCTATATCTCGAGATATAGAAGTCAGCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1403s21c1
Sequence:CCGGAGGCGTCCTCAGTGTTGTTACCTCGAGGTAACAACACTGAGGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-684s21c1
Sequence:CCGGGTAGAGCTTATGCACAGAAATCTCGAGATTTCTGTGCATAAGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1917s1c1
Sequence:CCGGCTTAAGACATTTCCTTGCAAACTCGAGTTTGCAAGGAAATGTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1933s1c1
Sequence:CCGGGCAAACGATTCAAAGAGGGTACTCGAGTACCCTCTTTGAATCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1655s1c1
Sequence:CCGGGTCTGAAAGCAGTCCAGCATTCTCGAGAATGCTGGACTGCTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198020
TRMT1 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1072s21c1
Sequence:CCGGACTTCTATATCCGGGTCTTTGCTCGAGCAAAGACCCGGATATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1927s21c1
Sequence:CCGGTTCCTTGCAAACGATTCAAAGCTCGAGCTTTGAATCGTTTGCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-684s1c1
Sequence:CCGGGTAGAGCTTATGCACAGAAATCTCGAGATTTCTGTGCATAAGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1061s1c1
Sequence:CCGGCATCAGTGCTGACTTCTATATCTCGAGATATAGAAGTCAGCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-1403s21c1
Sequence:CCGGAGGCGTCCTCAGTGTTGTTACCTCGAGGTAACAACACTGAGGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198020.1-684s21c1
Sequence:CCGGGTAGAGCTTATGCACAGAAATCTCGAGATTTCTGTGCATAAGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1917s1c1
Sequence:CCGGCTTAAGACATTTCCTTGCAAACTCGAGTTTGCAAGGAAATGTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1933s1c1
Sequence:CCGGGCAAACGATTCAAAGAGGGTACTCGAGTACCCTCTTTGAATCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198020.1-1655s1c1
Sequence:CCGGGTCTGAAAGCAGTCCAGCATTCTCGAGAATGCTGGACTGCTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks