EMAIL THIS PAGE TO A FRIEND

TRMT1L

tRNA methyltransferase 1 homolog (S. cerevisiae)-like

Synonyms: C1orf25 MST070 TRM1L bG120K12.3
UniProtKB ID: Q7Z2T5, Q5TEN0, Q6ZMX0, Q8IWH5, Q8NC68, Q9BZQ1
Gene ID:
Human(81627) Summary: This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
Mouse(98685) tRNA methyltransferase 1 like
Rat(304851) tRNA methyltransferase 1 homolog-like
Zebrafish(559583) tRNA methyltransferase 1 homolog (S. cerevisiae)-like
domestic cat(101086195) tRNA methyltransferase 1 homolog (S. cerevisiae)-like
dog(608468) tRNA methyltransferase 1 homolog (S. cerevisiae)-like
chicken(426860) TRM1 tRNA methyltransferase 1-like
cow(540872) tRNA methyltransferase 1 homolog (S. cerevisiae)-like
sheep(101108504) tRNA methyltransferase 1 homolog (S. cerevisiae)-like
domestic guinea pig(100719897) tRNA methyltransferase 1 homolog (S. cerevisiae)-like
naked mole-rat(101699299) tRNA methyltransferase 1 homolog (S. cerevisiae)-like
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408048 Anti-C1ORF25 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV30109 Anti-C1ORF25 antibody produced in rabbit affinity isolated antibody human, mouse, rat, canine, horse, bovine, pig
western blot pricing
SAB2104486 Anti-C1ORF25 antibody produced in rabbit affinity isolated antibody bovine, human, guinea pig, canine, horse
western blot pricing
HPA026728 Anti-TRMT1L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030934 Rosetta Predictions human pricing
NM_001037192 Rosetta Predictions rat pricing
NM_026876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195856 predicted 852
2 SASI_Hs01_00195857 predicted 1048
3 SASI_Hs02_00358496 predicted 1934
4 SASI_Hs01_00195858 predicted 2073
5 SASI_Hs01_00195859 predicted 970
6 SASI_Hs02_00358497 predicted 1342
7 SASI_Hs01_00195861 predicted 1836
8 SASI_Hs02_00358498 predicted 2253
9 SASI_Hs01_00195862 predicted 1706
10 SASI_Hs01_00195863 predicted 872
11 SASI_Hs01_00195860 predicted 1135
12 SASI_Hs01_00195864 predicted 1488
13 SASI_Hs01_00195865 predicted 2377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048874 predicted 1443
2 SASI_Rn01_00048875 predicted 1823
3 SASI_Rn01_00048876 predicted 916
4 SASI_Rn01_00048877 predicted 1158
5 SASI_Rn01_00048878 predicted 1265
6 SASI_Rn01_00048879 predicted 1090
7 SASI_Rn01_00048880 predicted 786
8 SASI_Rn01_00048881 predicted 1859
9 SASI_Rn01_00048882 predicted 742
10 SASI_Rn01_00048883 predicted 2025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066608 predicted 1467
2 SASI_Mm01_00066609 predicted 685
3 SASI_Mm01_00066610 predicted 727
4 SASI_Mm01_00066611 predicted 602
5 SASI_Mm01_00066612 predicted 1891
6 SASI_Mm02_00331122 predicted 658
7 SASI_Mm01_00066613 predicted 1069
8 SASI_Mm01_00066614 predicted 766
9 SASI_Mm01_00066615 predicted 1286
10 SASI_Mm01_00066616 predicted 1884
11 SASI_Mm01_00066617 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030934
VALIDATED
TRMT1L MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 1 homolog (S. cerevisiae)-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-1531s21c1
Sequence:CCGGACATTGTCCGAACTGAATATTCTCGAGAATATTCAGTTCGGACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-893s21c1
Sequence:CCGGGAATAAAGGAGAGACTAAATCCTCGAGGATTTAGTCTCTCCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2722s21c1
Sequence:CCGGGATCACCCTACTGCTTAATAACTCGAGTTATTAAGCAGTAGGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2501s21c1
Sequence:CCGGGTCTGTATAGATGGCCTAATACTCGAGTATTAGGCCATCTATACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-968s21c1
Sequence:CCGGAGACACGGATGTACAAGTTTGCTCGAGCAAACTTGTACATCCGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-1396s21c1
Sequence:CCGGTTGGAACATCAGTGAATTATCCTCGAGGATAATTCACTGATGTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2928s21c1
Sequence:CCGGATGTTCTTACAGGTCATAATGCTCGAGCATTATGACCTGTAAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-783s1c1
Sequence:CCGGGCCCATTATCATTGTATCATTCTCGAGAATGATACAATGATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030934.3-1908s1c1
Sequence:CCGGCAGACCCTAATAAAGACATTACTCGAGTAATGTCTTTATTAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-1137s1c1
Sequence:CCGGGCAGTCAAAGTTACAATCAATCTCGAGATTGATTGTAACTTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-553s1c1
Sequence:CCGGCCAGCTCATTGAACTCAGATACTCGAGTATCTGAGTTCAATGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_030934.3-1019s1c1
Sequence:CCGGGCAGCTAATATTCTGTACATTCTCGAGAATGTACAGAATATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030934
VALIDATED
TRMT1L MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 1 homolog (S. cerevisiae)-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-1531s21c1
Sequence:CCGGACATTGTCCGAACTGAATATTCTCGAGAATATTCAGTTCGGACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-893s21c1
Sequence:CCGGGAATAAAGGAGAGACTAAATCCTCGAGGATTTAGTCTCTCCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2722s21c1
Sequence:CCGGGATCACCCTACTGCTTAATAACTCGAGTTATTAAGCAGTAGGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2501s21c1
Sequence:CCGGGTCTGTATAGATGGCCTAATACTCGAGTATTAGGCCATCTATACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-968s21c1
Sequence:CCGGAGACACGGATGTACAAGTTTGCTCGAGCAAACTTGTACATCCGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-1396s21c1
Sequence:CCGGTTGGAACATCAGTGAATTATCCTCGAGGATAATTCACTGATGTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2928s21c1
Sequence:CCGGATGTTCTTACAGGTCATAATGCTCGAGCATTATGACCTGTAAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-783s1c1
Sequence:CCGGGCCCATTATCATTGTATCATTCTCGAGAATGATACAATGATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030934.3-1908s1c1
Sequence:CCGGCAGACCCTAATAAAGACATTACTCGAGTAATGTCTTTATTAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-1137s1c1
Sequence:CCGGGCAGTCAAAGTTACAATCAATCTCGAGATTGATTGTAACTTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-553s1c1
Sequence:CCGGCCAGCTCATTGAACTCAGATACTCGAGTATCTGAGTTCAATGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_030934.3-1019s1c1
Sequence:CCGGGCAGCTAATATTCTGTACATTCTCGAGAATGTACAGAATATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030934
VALIDATED
TRMT1L MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 1 homolog (S. cerevisiae)-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-1531s21c1
Sequence:CCGGACATTGTCCGAACTGAATATTCTCGAGAATATTCAGTTCGGACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-893s21c1
Sequence:CCGGGAATAAAGGAGAGACTAAATCCTCGAGGATTTAGTCTCTCCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2722s21c1
Sequence:CCGGGATCACCCTACTGCTTAATAACTCGAGTTATTAAGCAGTAGGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2501s21c1
Sequence:CCGGGTCTGTATAGATGGCCTAATACTCGAGTATTAGGCCATCTATACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-968s21c1
Sequence:CCGGAGACACGGATGTACAAGTTTGCTCGAGCAAACTTGTACATCCGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030934.4-1396s21c1
Sequence:CCGGTTGGAACATCAGTGAATTATCCTCGAGGATAATTCACTGATGTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030934.4-2928s21c1
Sequence:CCGGATGTTCTTACAGGTCATAATGCTCGAGCATTATGACCTGTAAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-783s1c1
Sequence:CCGGGCCCATTATCATTGTATCATTCTCGAGAATGATACAATGATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030934.3-1908s1c1
Sequence:CCGGCAGACCCTAATAAAGACATTACTCGAGTAATGTCTTTATTAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-1137s1c1
Sequence:CCGGGCAGTCAAAGTTACAATCAATCTCGAGATTGATTGTAACTTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_030934.3-553s1c1
Sequence:CCGGCCAGCTCATTGAACTCAGATACTCGAGTATCTGAGTTCAATGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_030934.3-1019s1c1
Sequence:CCGGGCAGCTAATATTCTGTACATTCTCGAGAATGTACAGAATATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026876
VALIDATED
TRMT1L MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 1 homolog (S. cerevisiae)-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-2427s21c1
Sequence:CCGGGTTCTTCTCAGGGTTCTGTATCTCGAGATACAGAACCCTGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026876.2-533s21c1
Sequence:CCGGGCCAGTTCATTGAACTCAGATCTCGAGATCTGAGTTCAATGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-2002s21c1
Sequence:CCGGCGATGATACCACAATAGATATCTCGAGATATCTATTGTGGTATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026876.2-753s21c1
Sequence:CCGGGTAAACTGGGAGCCCATTATCCTCGAGGATAATGGGCTCCCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-1602s21c1
Sequence:CCGGTGGTAGTTGTGAGGGTCTTAACTCGAGTTAAGACCCTCACAACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-2428s1c1
Sequence:CCGGGTTCTTCTCAGGGTTCTGTATCTCGAGATACAGAACCCTGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-534s1c1
Sequence:CCGGGCCAGTTCATTGAACTCAGATCTCGAGATCTGAGTTCAATGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026876.1-1074s1c1
Sequence:CCGGGCCACTGGAATAATGGGATTACTCGAGTAATCCCATTATTCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-2135s1c1
Sequence:CCGGGCACAGCATCAAAGGGATGAACTCGAGTTCATCCCTTTGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026876.1-1548s1c1
Sequence:CCGGCGGTGCAACAAAGGTATAGAACTCGAGTTCTATACCTTTGTTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026876
VALIDATED
TRMT1L MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 1 homolog (S. cerevisiae)-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-2427s21c1
Sequence:CCGGGTTCTTCTCAGGGTTCTGTATCTCGAGATACAGAACCCTGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026876.2-533s21c1
Sequence:CCGGGCCAGTTCATTGAACTCAGATCTCGAGATCTGAGTTCAATGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-2002s21c1
Sequence:CCGGCGATGATACCACAATAGATATCTCGAGATATCTATTGTGGTATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026876.2-753s21c1
Sequence:CCGGGTAAACTGGGAGCCCATTATCCTCGAGGATAATGGGCTCCCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-1602s21c1
Sequence:CCGGTGGTAGTTGTGAGGGTCTTAACTCGAGTTAAGACCCTCACAACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-2428s1c1
Sequence:CCGGGTTCTTCTCAGGGTTCTGTATCTCGAGATACAGAACCCTGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-534s1c1
Sequence:CCGGGCCAGTTCATTGAACTCAGATCTCGAGATCTGAGTTCAATGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026876.1-1074s1c1
Sequence:CCGGGCCACTGGAATAATGGGATTACTCGAGTAATCCCATTATTCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-2135s1c1
Sequence:CCGGGCACAGCATCAAAGGGATGAACTCGAGTTCATCCCTTTGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026876.1-1548s1c1
Sequence:CCGGCGGTGCAACAAAGGTATAGAACTCGAGTTCTATACCTTTGTTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026876
VALIDATED
TRMT1L MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 1 homolog (S. cerevisiae)-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-2427s21c1
Sequence:CCGGGTTCTTCTCAGGGTTCTGTATCTCGAGATACAGAACCCTGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026876.2-533s21c1
Sequence:CCGGGCCAGTTCATTGAACTCAGATCTCGAGATCTGAGTTCAATGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-2002s21c1
Sequence:CCGGCGATGATACCACAATAGATATCTCGAGATATCTATTGTGGTATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026876.2-753s21c1
Sequence:CCGGGTAAACTGGGAGCCCATTATCCTCGAGGATAATGGGCTCCCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026876.2-1602s21c1
Sequence:CCGGTGGTAGTTGTGAGGGTCTTAACTCGAGTTAAGACCCTCACAACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-2428s1c1
Sequence:CCGGGTTCTTCTCAGGGTTCTGTATCTCGAGATACAGAACCCTGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-534s1c1
Sequence:CCGGGCCAGTTCATTGAACTCAGATCTCGAGATCTGAGTTCAATGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026876.1-1074s1c1
Sequence:CCGGGCCACTGGAATAATGGGATTACTCGAGTAATCCCATTATTCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026876.1-2135s1c1
Sequence:CCGGGCACAGCATCAAAGGGATGAACTCGAGTTCATCCCTTTGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026876.1-1548s1c1
Sequence:CCGGCGGTGCAACAAAGGTATAGAACTCGAGTTCTATACCTTTGTTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks