EMAIL THIS PAGE TO A FRIEND

TRMT2A

tRNA methyltransferase 2 homolog A (S. cerevisiae)

Synonyms: HTF9C
UniProtKB ID: Q8IZ69, D3DX25, Q32P57, Q96ME6, Q9H732
Gene ID:
Human(27037) Summary: The protein encoded by this gene is of unknown function. However, it is orthologous to the mouse Trmt2a gene and contains an RNA methyltransferase domain. Expression of this gene varies during the cell cycle, with aberrant expression being a possible biomarker in certain breast cancers. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(15547) TRM2 tRNA methyltransferase 2A
Rat(287953) tRNA methyltransferase 2 homolog A (S. cerevisiae)
naked mole-rat(101726103) tRNA methyltransferase 2 homolog A (S. cerevisiae)
domestic guinea pig(100712686) tRNA methyltransferase 2 homolog A (S. cerevisiae)
cow(281834) tRNA methyltransferase 2 homolog A (S. cerevisiae)
sheep(101122385) tRNA methyltransferase 2 homolog A (S. cerevisiae)
Zebrafish(334936) trm2 tRNA methyltransferase 2 homolog A (S. cerevisiae)
Horse(100051668) tRNA methyltransferase 2 homolog A (S. cerevisiae)
domestic cat(101101171) tRNA methyltransferase 2 homolog A (S. cerevisiae)
dog(477564) tRNA methyltransferase 2 homolog A (S. cerevisiae)
chicken(416786) tRNA methyltransferase 2 homolog A (S. cerevisiae)
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182984 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022727 Rosetta Predictions human pricing
NM_182984 Rosetta Predictions human pricing
NM_001011895 Rosetta Predictions rat pricing
XM_573324 Rosetta Predictions rat pricing
NM_001080999 Rosetta Predictions mouse pricing
NM_001081000 Rosetta Predictions mouse pricing
NM_008307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060535 predicted 535
2 SASI_Hs02_00355952 predicted 1257
3 SASI_Hs01_00060536 predicted 514
4 SASI_Hs01_00060537 predicted 1759
5 SASI_Hs01_00060538 predicted 2618
6 SASI_Hs01_00060539 predicted 2041
7 SASI_Hs01_00060540 predicted 1157
8 SASI_Hs01_00060541 predicted 2421
9 SASI_Hs01_00060542 predicted 2451
10 SASI_Hs01_00060543 predicted 1037
11 SASI_Hs01_00060534 predicted 2287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080726 predicted 413
2 SASI_Hs02_00371156 predicted 1131
3 SASI_Hs01_00080727 predicted 390
4 SASI_Hs01_00080728 predicted 1634
5 SASI_Hs01_00080729 predicted 2493
6 SASI_Hs01_00080730 predicted 1914
7 SASI_Hs01_00080731 predicted 1031
8 SASI_Hs01_00080732 predicted 2299
9 SASI_Hs01_00080733 predicted 2328
10 SASI_Hs01_00080734 predicted 912
11 SASI_Hs01_00080725 predicted 2156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037246 predicted 693
2 SASI_Rn01_00037247 predicted 1758
3 SASI_Rn01_00037248 predicted 576
4 SASI_Rn01_00037249 predicted 868
5 SASI_Rn01_00037250 predicted 936
6 SASI_Rn01_00037251 predicted 1428
7 SASI_Rn01_00037252 predicted 1063
8 SASI_Rn02_00199875 predicted 1132
9 SASI_Rn01_00037253 predicted 1050
10 SASI_Rn01_00037254 predicted 1032
11 SASI_Rn01_00037245 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190852 predicted 715
2 SASI_Rn01_00190853 predicted 697
3 SASI_Rn01_00190854 predicted 1757
4 SASI_Rn01_00190855 predicted 584
5 SASI_Rn01_00190856 predicted 872
6 SASI_Rn01_00190857 predicted 942
7 SASI_Rn01_00190858 predicted 1434
8 SASI_Rn01_00190859 predicted 1061
9 SASI_Rn01_00190860 predicted 1053
10 SASI_Rn01_00190861 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294266 predicted 1857
2 SASI_Mm02_00294267 predicted 1190
3 SASI_Mm02_00294268 predicted 1820
4 SASI_Mm02_00294269 predicted 1891
5 SASI_Mm02_00294270 predicted 2053
6 SASI_Mm02_00294271 predicted 682
7 SASI_Mm02_00294272 predicted 2128
8 SASI_Mm02_00294273 predicted 1536
9 SASI_Mm02_00294274 predicted 1165
10 SASI_Mm02_00294275 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294276 predicted 1904
2 SASI_Mm02_00294277 predicted 1235
3 SASI_Mm02_00294278 predicted 1869
4 SASI_Mm02_00294279 predicted 1941
5 SASI_Mm02_00294280 predicted 2103
6 SASI_Mm02_00294281 predicted 726
7 SASI_Mm02_00294282 predicted 2179
8 SASI_Mm02_00294283 predicted 1575
9 SASI_Mm02_00294284 predicted 1211
10 SASI_Mm02_00294285 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153480 predicted 2092
2 SASI_Mm02_00313615 predicted 1426
3 SASI_Mm01_00153481 predicted 2053
4 SASI_Mm01_00153482 predicted 2122
5 SASI_Mm02_00313616 predicted 2288
6 SASI_Mm02_00313617 predicted 916
7 SASI_Mm01_00153485 predicted 2365
8 SASI_Mm01_00153486 predicted 1768
9 SASI_Mm02_00313618 predicted 1399
10 SASI_Mm02_00313619 predicted 1458
11 SASI_Mm01_00153478 predicted 1235
12 SASI_Mm01_00153479 predicted 668
13 SASI_Mm01_00153483 predicted 1120
14 SASI_Mm01_00153484 predicted 1250
15 SASI_Mm01_00153487 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022727
VALIDATED
TRMT2A MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022727.4-516s1c1
Sequence:CCGGCTACAGCTACATCAGGGATGACTCGAGTCATCCCTGATGTAGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022727.4-2454s1c1
Sequence:CCGGGCCAGAATAAACAACTGCTCACTCGAGTGAGCAGTTGTTTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022727.4-2589s1c1
Sequence:CCGGGTCAGGGCAGAGCTTACTTTACTCGAGTAAAGTAAGCTCTGCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022727.4-2002s21c1
Sequence:CCGGTCTAACCGGGTGAAGGGCATTCTCGAGAATGCCCTTCACCCGGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022727.4-2077s21c1
Sequence:CCGGTGTGAGATGCTCATCCTGTTTCTCGAGAAACAGGATGAGCATCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022727.4-2479s21c1
Sequence:CCGGAGGGTGTTTCTGTGATGAGAGCTCGAGCTCTCATCACAGAAACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022727
VALIDATED
TRMT2A MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022727.4-516s1c1
Sequence:CCGGCTACAGCTACATCAGGGATGACTCGAGTCATCCCTGATGTAGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022727.4-2454s1c1
Sequence:CCGGGCCAGAATAAACAACTGCTCACTCGAGTGAGCAGTTGTTTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022727.4-2589s1c1
Sequence:CCGGGTCAGGGCAGAGCTTACTTTACTCGAGTAAAGTAAGCTCTGCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022727.4-2002s21c1
Sequence:CCGGTCTAACCGGGTGAAGGGCATTCTCGAGAATGCCCTTCACCCGGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022727.4-2077s21c1
Sequence:CCGGTGTGAGATGCTCATCCTGTTTCTCGAGAAACAGGATGAGCATCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022727.4-2479s21c1
Sequence:CCGGAGGGTGTTTCTGTGATGAGAGCTCGAGCTCTCATCACAGAAACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022727
VALIDATED
TRMT2A MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022727.4-516s1c1
Sequence:CCGGCTACAGCTACATCAGGGATGACTCGAGTCATCCCTGATGTAGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022727.4-2454s1c1
Sequence:CCGGGCCAGAATAAACAACTGCTCACTCGAGTGAGCAGTTGTTTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022727.4-2589s1c1
Sequence:CCGGGTCAGGGCAGAGCTTACTTTACTCGAGTAAAGTAAGCTCTGCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022727.4-2002s21c1
Sequence:CCGGTCTAACCGGGTGAAGGGCATTCTCGAGAATGCCCTTCACCCGGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022727.4-2077s21c1
Sequence:CCGGTGTGAGATGCTCATCCTGTTTCTCGAGAAACAGGATGAGCATCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022727.4-2479s21c1
Sequence:CCGGAGGGTGTTTCTGTGATGAGAGCTCGAGCTCTCATCACAGAAACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182984
VALIDATED
TRMT2A MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_182984.2-1505s1c1
Sequence:CCGGCGGAAGGTAAAGAGGGTCATTCTCGAGAATGACCCTCTTTACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_182984.2-856s1c1
Sequence:CCGGGCAGACTGAGTATCGTAATAACTCGAGTTATTACGATACTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_182984.2-1574s1c1
Sequence:CCGGCAGGACAATGAGTTGAGTAATCTCGAGATTACTCAACTCATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_182984.2-736s1c1
Sequence:CCGGGCAGAAACTTGCCAAGGAAATCTCGAGATTTCCTTGGCAAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182984.2-1985s1c1
Sequence:CCGGCCAGATAACACCCTACAAGAACTCGAGTTCTTGTAGGGTGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182984.2-1996s1c1
Sequence:CCGGCCTACAAGAAACTGGGACCTTCTCGAGAAGGTCCCAGTTTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182984
VALIDATED
TRMT2A MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_182984.2-1505s1c1
Sequence:CCGGCGGAAGGTAAAGAGGGTCATTCTCGAGAATGACCCTCTTTACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_182984.2-856s1c1
Sequence:CCGGGCAGACTGAGTATCGTAATAACTCGAGTTATTACGATACTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_182984.2-1574s1c1
Sequence:CCGGCAGGACAATGAGTTGAGTAATCTCGAGATTACTCAACTCATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_182984.2-736s1c1
Sequence:CCGGGCAGAAACTTGCCAAGGAAATCTCGAGATTTCCTTGGCAAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182984.2-1985s1c1
Sequence:CCGGCCAGATAACACCCTACAAGAACTCGAGTTCTTGTAGGGTGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182984.2-1996s1c1
Sequence:CCGGCCTACAAGAAACTGGGACCTTCTCGAGAAGGTCCCAGTTTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182984
VALIDATED
TRMT2A MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_182984.2-1505s1c1
Sequence:CCGGCGGAAGGTAAAGAGGGTCATTCTCGAGAATGACCCTCTTTACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_182984.2-856s1c1
Sequence:CCGGGCAGACTGAGTATCGTAATAACTCGAGTTATTACGATACTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_182984.2-1574s1c1
Sequence:CCGGCAGGACAATGAGTTGAGTAATCTCGAGATTACTCAACTCATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_182984.2-736s1c1
Sequence:CCGGGCAGAAACTTGCCAAGGAAATCTCGAGATTTCCTTGGCAAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182984.2-1985s1c1
Sequence:CCGGCCAGATAACACCCTACAAGAACTCGAGTTCTTGTAGGGTGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182984.2-1996s1c1
Sequence:CCGGCCTACAAGAAACTGGGACCTTCTCGAGAAGGTCCCAGTTTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008307
VALIDATED
TRMT2A MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008307.1-2637s1c1
Sequence:CCGGGAAGTATAGGAGCACAGGAAACTCGAGTTTCCTGTGCTCCTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008307.1-2357s1c1
Sequence:CCGGGACTCCTGTATGTTTCCTGTACTCGAGTACAGGAAACATACAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008307.1-952s1c1
Sequence:CCGGGATGACTTGTTCACATCAGAACTCGAGTTCTGATGTGAACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-1257s21c1
Sequence:CCGGGCAGACTGAATATCGTAATAACTCGAGTTATTACGATATTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008307.2-2427s21c1
Sequence:CCGGGAAGTATAGGAGCACAGGAAACTCGAGTTTCCTGTGCTCCTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-745s21c1
Sequence:CCGGGATGACTTGTTCACATCAGAACTCGAGTTCTGATGTGAACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-2370s21c1
Sequence:CCGGCCCAAGAAATCTTCCTGATATCTCGAGATATCAGGAAGATTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008307
VALIDATED
TRMT2A MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008307.1-2637s1c1
Sequence:CCGGGAAGTATAGGAGCACAGGAAACTCGAGTTTCCTGTGCTCCTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008307.1-2357s1c1
Sequence:CCGGGACTCCTGTATGTTTCCTGTACTCGAGTACAGGAAACATACAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008307.1-952s1c1
Sequence:CCGGGATGACTTGTTCACATCAGAACTCGAGTTCTGATGTGAACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-1257s21c1
Sequence:CCGGGCAGACTGAATATCGTAATAACTCGAGTTATTACGATATTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008307.2-2427s21c1
Sequence:CCGGGAAGTATAGGAGCACAGGAAACTCGAGTTTCCTGTGCTCCTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-745s21c1
Sequence:CCGGGATGACTTGTTCACATCAGAACTCGAGTTCTGATGTGAACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-2370s21c1
Sequence:CCGGCCCAAGAAATCTTCCTGATATCTCGAGATATCAGGAAGATTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008307
VALIDATED
TRMT2A MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 2 homolog A (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008307.1-2637s1c1
Sequence:CCGGGAAGTATAGGAGCACAGGAAACTCGAGTTTCCTGTGCTCCTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008307.1-2357s1c1
Sequence:CCGGGACTCCTGTATGTTTCCTGTACTCGAGTACAGGAAACATACAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008307.1-952s1c1
Sequence:CCGGGATGACTTGTTCACATCAGAACTCGAGTTCTGATGTGAACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-1257s21c1
Sequence:CCGGGCAGACTGAATATCGTAATAACTCGAGTTATTACGATATTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008307.2-2427s21c1
Sequence:CCGGGAAGTATAGGAGCACAGGAAACTCGAGTTTCCTGTGCTCCTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-745s21c1
Sequence:CCGGGATGACTTGTTCACATCAGAACTCGAGTTCTGATGTGAACAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008307.2-2370s21c1
Sequence:CCGGCCCAAGAAATCTTCCTGATATCTCGAGATATCAGGAAGATTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks