EMAIL THIS PAGE TO A FRIEND

TRMT2B

tRNA methyltransferase 2 homolog B (S. cerevisiae)

Synonyms: CXorf34 dJ341D10.3
Gene ID:
Human(79979) Summary: This gene encodes a homolog of the TRM2 gene in S. cerevisiae. The yeast gene encodes a tRNA methyltransferase that plays a role in tRNA maturation. The yeast protein also has endo-exonuclease activity and may be involved in DNA double strand break repair. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Nov 2009]
Mouse(215201) TRM2 tRNA methyltransferase 2B
Zebrafish(606657) TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae)
chicken(422195) TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae)
dog(609609) TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae)
cow(100336991) tRNA methyltransferase 2 homolog B (S. cerevisiae)
sheep(101119702) tRNA methyltransferase 2 homolog B (S. cerevisiae)
Domestic Rabbit(100338690) tRNA methyltransferase 2 homolog B (S. cerevisiae)
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024917 Rosetta Predictions human pricing
NM_172540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024486 predicted 937
2 SASI_Hs01_00024487 predicted 1177
3 SASI_Hs01_00024488 predicted 1714
4 SASI_Hs01_00024489 predicted 1174
5 SASI_Hs01_00024490 predicted 2175
6 SASI_Hs01_00024491 predicted 1809
7 SASI_Hs01_00024492 predicted 807
8 SASI_Hs01_00024493 predicted 978
9 SASI_Hs01_00024495 predicted 1212
10 SASI_Hs02_00357530 predicted 1113
11 SASI_Hs01_00024494 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182430 predicted 1058
2 SASI_Mm01_00182431 predicted 1486
3 SASI_Mm01_00182432 predicted 1172
4 SASI_Mm01_00182433 predicted 1000
5 SASI_Mm01_00182434 predicted 580
6 SASI_Mm01_00182435 predicted 784
7 SASI_Mm01_00182436 predicted 1462
8 SASI_Mm01_00182437 predicted 678
9 SASI_Mm01_00182438 predicted 1127
10 SASI_Mm01_00182439 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172540
VALIDATED
TRMT2B MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 2 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1394s21c1
Sequence:CCGGTGCCCGAGCTGGATTGCATTACTCGAGTAATGCAATCCAGCTCGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172540.2-1839s21c1
Sequence:CCGGTAACTCCTTGAACCTGAATTTCTCGAGAAATTCAGGTTCAAGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1052s21c1
Sequence:CCGGGGGTTTGAAGATTCGAATTTCCTCGAGGAAATTCGAATCTTCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1511s21c1
Sequence:CCGGACTATGCTGTCCTCCAAATTCCTCGAGGAATTTGGAGGACAGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1157s21c1
Sequence:CCGGGAGCCTCCTCCTAGACATTTGCTCGAGCAAATGTCTAGGAGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172540.1-2703s1c1
Sequence:CCGGCCTGAGTTTGATTGTTAGTATCTCGAGATACTAACAATCAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-218s1c1
Sequence:CCGGGCAGAGCATATAAAGGGAGTTCTCGAGAACTCCCTTTATATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-370s1c1
Sequence:CCGGGCACAACTCAAGGTGAAATTTCTCGAGAAATTTCACCTTGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172540.1-1528s1c1
Sequence:CCGGGCTGTACCTGTGGATTTGTTTCTCGAGAAACAAATCCACAGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-908s1c1
Sequence:CCGGCCTCGCTCTATTTCCAGGAAACTCGAGTTTCCTGGAAATAGAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172540
VALIDATED
TRMT2B MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 2 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1394s21c1
Sequence:CCGGTGCCCGAGCTGGATTGCATTACTCGAGTAATGCAATCCAGCTCGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172540.2-1839s21c1
Sequence:CCGGTAACTCCTTGAACCTGAATTTCTCGAGAAATTCAGGTTCAAGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1052s21c1
Sequence:CCGGGGGTTTGAAGATTCGAATTTCCTCGAGGAAATTCGAATCTTCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1511s21c1
Sequence:CCGGACTATGCTGTCCTCCAAATTCCTCGAGGAATTTGGAGGACAGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1157s21c1
Sequence:CCGGGAGCCTCCTCCTAGACATTTGCTCGAGCAAATGTCTAGGAGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172540.1-2703s1c1
Sequence:CCGGCCTGAGTTTGATTGTTAGTATCTCGAGATACTAACAATCAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-218s1c1
Sequence:CCGGGCAGAGCATATAAAGGGAGTTCTCGAGAACTCCCTTTATATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-370s1c1
Sequence:CCGGGCACAACTCAAGGTGAAATTTCTCGAGAAATTTCACCTTGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172540.1-1528s1c1
Sequence:CCGGGCTGTACCTGTGGATTTGTTTCTCGAGAAACAAATCCACAGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-908s1c1
Sequence:CCGGCCTCGCTCTATTTCCAGGAAACTCGAGTTTCCTGGAAATAGAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172540
VALIDATED
TRMT2B MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 2 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1394s21c1
Sequence:CCGGTGCCCGAGCTGGATTGCATTACTCGAGTAATGCAATCCAGCTCGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172540.2-1839s21c1
Sequence:CCGGTAACTCCTTGAACCTGAATTTCTCGAGAAATTCAGGTTCAAGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1052s21c1
Sequence:CCGGGGGTTTGAAGATTCGAATTTCCTCGAGGAAATTCGAATCTTCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1511s21c1
Sequence:CCGGACTATGCTGTCCTCCAAATTCCTCGAGGAATTTGGAGGACAGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172540.2-1157s21c1
Sequence:CCGGGAGCCTCCTCCTAGACATTTGCTCGAGCAAATGTCTAGGAGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172540.1-2703s1c1
Sequence:CCGGCCTGAGTTTGATTGTTAGTATCTCGAGATACTAACAATCAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-218s1c1
Sequence:CCGGGCAGAGCATATAAAGGGAGTTCTCGAGAACTCCCTTTATATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-370s1c1
Sequence:CCGGGCACAACTCAAGGTGAAATTTCTCGAGAAATTTCACCTTGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172540.1-1528s1c1
Sequence:CCGGGCTGTACCTGTGGATTTGTTTCTCGAGAAACAAATCCACAGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172540.1-908s1c1
Sequence:CCGGCCTCGCTCTATTTCCAGGAAACTCGAGTTTCCTGGAAATAGAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024917
VALIDATED
TRMT2B MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 2 homolog B (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-1215s21c1
Sequence:CCGGCATCAATGGTTACCGAAATAACTCGAGTTATTTCGGTAACCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-1964s21c1
Sequence:CCGGCTGGTCAAGCAGAGAAGATTTCTCGAGAAATCTTCTCTGCTTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-2739s21c1
Sequence:CCGGCGGCTGACTTAACCTTAGATTCTCGAGAATCTAAGGTTAAGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-930s21c1
Sequence:CCGGCCGTGTGATAGCCACGAAATGCTCGAGCATTTCGTGGCTATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024917.4-905s21c1
Sequence:CCGGGCACAGTATGTAAGGGAGATTCTCGAGAATCTCCCTTACATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-2130s1c1
Sequence:CCGGCCATGGTGAATCCACTAGGAACTCGAGTTCCTAGTGGATTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024917.4-1210s1c1
Sequence:CCGGCCTGTCATCAATGGTTACCGACTCGAGTCGGTAACCATTGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024917.4-2131s1c1
Sequence:CCGGCATGGTGAATCCACTAGGAATCTCGAGATTCCTAGTGGATTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-1109s1c1
Sequence:CCGGGACTAGAGTCTTACATCCAAACTCGAGTTTGGATGTAAGACTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-905s1c1
Sequence:CCGGGCACAGTATGTAAGGGAGATTCTCGAGAATCTCCCTTACATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-2739s1c1
Sequence:CCGGCGGCTGACTTAACCTTAGATTCTCGAGAATCTAAGGTTAAGTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-1964s1c1
Sequence:CCGGCTGGTCAAGCAGAGAAGATTTCTCGAGAAATCTTCTCTGCTTGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024917
VALIDATED
TRMT2B MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 2 homolog B (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-1215s21c1
Sequence:CCGGCATCAATGGTTACCGAAATAACTCGAGTTATTTCGGTAACCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-1964s21c1
Sequence:CCGGCTGGTCAAGCAGAGAAGATTTCTCGAGAAATCTTCTCTGCTTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-2739s21c1
Sequence:CCGGCGGCTGACTTAACCTTAGATTCTCGAGAATCTAAGGTTAAGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-930s21c1
Sequence:CCGGCCGTGTGATAGCCACGAAATGCTCGAGCATTTCGTGGCTATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024917.4-905s21c1
Sequence:CCGGGCACAGTATGTAAGGGAGATTCTCGAGAATCTCCCTTACATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-2130s1c1
Sequence:CCGGCCATGGTGAATCCACTAGGAACTCGAGTTCCTAGTGGATTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024917.4-1210s1c1
Sequence:CCGGCCTGTCATCAATGGTTACCGACTCGAGTCGGTAACCATTGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024917.4-2131s1c1
Sequence:CCGGCATGGTGAATCCACTAGGAATCTCGAGATTCCTAGTGGATTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-1109s1c1
Sequence:CCGGGACTAGAGTCTTACATCCAAACTCGAGTTTGGATGTAAGACTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-905s1c1
Sequence:CCGGGCACAGTATGTAAGGGAGATTCTCGAGAATCTCCCTTACATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-2739s1c1
Sequence:CCGGCGGCTGACTTAACCTTAGATTCTCGAGAATCTAAGGTTAAGTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-1964s1c1
Sequence:CCGGCTGGTCAAGCAGAGAAGATTTCTCGAGAAATCTTCTCTGCTTGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024917
VALIDATED
TRMT2B MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 2 homolog B (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-1215s21c1
Sequence:CCGGCATCAATGGTTACCGAAATAACTCGAGTTATTTCGGTAACCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-1964s21c1
Sequence:CCGGCTGGTCAAGCAGAGAAGATTTCTCGAGAAATCTTCTCTGCTTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-2739s21c1
Sequence:CCGGCGGCTGACTTAACCTTAGATTCTCGAGAATCTAAGGTTAAGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024917.4-930s21c1
Sequence:CCGGCCGTGTGATAGCCACGAAATGCTCGAGCATTTCGTGGCTATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024917.4-905s21c1
Sequence:CCGGGCACAGTATGTAAGGGAGATTCTCGAGAATCTCCCTTACATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-2130s1c1
Sequence:CCGGCCATGGTGAATCCACTAGGAACTCGAGTTCCTAGTGGATTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024917.4-1210s1c1
Sequence:CCGGCCTGTCATCAATGGTTACCGACTCGAGTCGGTAACCATTGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024917.4-2131s1c1
Sequence:CCGGCATGGTGAATCCACTAGGAATCTCGAGATTCCTAGTGGATTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-1109s1c1
Sequence:CCGGGACTAGAGTCTTACATCCAAACTCGAGTTTGGATGTAAGACTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-905s1c1
Sequence:CCGGGCACAGTATGTAAGGGAGATTCTCGAGAATCTCCCTTACATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-2739s1c1
Sequence:CCGGCGGCTGACTTAACCTTAGATTCTCGAGAATCTAAGGTTAAGTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024917.4-1964s1c1
Sequence:CCGGCTGGTCAAGCAGAGAAGATTTCTCGAGAAATCTTCTCTGCTTGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks