EMAIL THIS PAGE TO A FRIEND

TRMT44

tRNA methyltransferase 44 homolog (S. cerevisiae)

Synonyms: C4orf23 METTL19 TRM44
UniProtKB ID: Q8IYL2, Q8NA95
Gene ID:
Human(152992) Summary: The protein encoded by this gene is a putative tRNA methyltransferase found in the cytoplasm. Defects in this gene may be a cause of partial epilepsy with pericentral spikes (PEPS), but that has not been proven definitively. [provided by RefSeq, May 2012]
Mouse(78890) tRNA methyltransferase 44
Rat(305443) tRNA methyltransferase 44 homolog (S. cerevisiae)
naked mole-rat(101720763) tRNA methyltransferase 44 homolog (S. cerevisiae)
domestic guinea pig(100735596) tRNA methyltransferase 44 homolog (S. cerevisiae)
cow(513470) tRNA methyltransferase 44 homolog (S. cerevisiae)
sheep(101120164) tRNA methyltransferase 44 homolog (S. cerevisiae)
Zebrafish(450066) tRNA methyltransferase 44 homolog (S. cerevisiae)
domestic cat(101088484) tRNA methyltransferase 44 homolog (S. cerevisiae)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152544 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152544 Rosetta Predictions human pricing
NM_001130061 Rosetta Predictions rat pricing
NM_030208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244374 predicted 430
2 SASI_Hs01_00244375 predicted 911
3 SASI_Hs01_00244376 predicted 231
4 SASI_Hs01_00244377 predicted 201
5 SASI_Hs01_00244378 predicted 339
6 SASI_Hs02_00366348 predicted 285
7 SASI_Hs01_00244379 predicted 488
8 SASI_Hs01_00244380 predicted 1117
9 SASI_Hs01_00244381 predicted 551
10 SASI_Hs01_00244382 predicted 418
11 SASI_Hs01_00244383 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255289 predicted 581
2 SASI_Rn02_00255290 predicted 782
3 SASI_Rn02_00255291 predicted 1250
4 SASI_Rn02_00255292 predicted 578
5 SASI_Rn02_00255293 predicted 546
6 SASI_Rn02_00255294 predicted 515
7 SASI_Rn02_00255295 predicted 431
8 SASI_Rn02_00255296 predicted 858
9 SASI_Rn02_00255297 predicted 793
10 SASI_Rn02_00255298 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140467 predicted 608
2 SASI_Mm01_00140468 predicted 815
3 SASI_Mm01_00140469 predicted 885
4 SASI_Mm01_00140470 predicted 975
5 SASI_Mm01_00140471 predicted 241
6 SASI_Mm01_00140472 predicted 1187
7 SASI_Mm01_00140473 predicted 1723
8 SASI_Mm01_00140474 predicted 477
9 SASI_Mm02_00336637 predicted 785
10 SASI_Mm01_00140475 predicted 824
11 SASI_Mm01_00140476 predicted 1920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152544
TRMT44 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 44 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-1055s1c1
Sequence:CCGGCCAGGTGTTCCAAGTTGTGAACTCGAGTTCACAACTTGGAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-429s1c1
Sequence:CCGGCGGGAATACCTTGACTTCATTCTCGAGAATGAAGTCAAGGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-783s1c1
Sequence:CCGGCCTGGATTTCATCCCAGAGAACTCGAGTTCTCTGGGATGAAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-428s1c1
Sequence:CCGGCCGGGAATACCTTGACTTCATCTCGAGATGAAGTCAAGGTATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-241s1c1
Sequence:CCGGCACCCAATGATAAGACCCTTTCTCGAGAAAGGGTCTTATCATTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-874s1c1
Sequence:CCGGCGAATTTACTGTTAGGTGGAACTCGAGTTCCACCTAACAGTAAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152544.1-1540s1c1
Sequence:CCGGCGCAGCATCTTCATATCATAACTCGAGTTATGATATGAAGATGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-263s1c1
Sequence:CCGGCCCTGATGTTGATTGGTTAATCTCGAGATTAACCAATCAACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152544.1-1541s1c1
Sequence:CCGGGCAGCATCTTCATATCATAAACTCGAGTTTATGATATGAAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152544
TRMT44 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 44 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-1055s1c1
Sequence:CCGGCCAGGTGTTCCAAGTTGTGAACTCGAGTTCACAACTTGGAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-429s1c1
Sequence:CCGGCGGGAATACCTTGACTTCATTCTCGAGAATGAAGTCAAGGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-783s1c1
Sequence:CCGGCCTGGATTTCATCCCAGAGAACTCGAGTTCTCTGGGATGAAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-428s1c1
Sequence:CCGGCCGGGAATACCTTGACTTCATCTCGAGATGAAGTCAAGGTATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-241s1c1
Sequence:CCGGCACCCAATGATAAGACCCTTTCTCGAGAAAGGGTCTTATCATTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-874s1c1
Sequence:CCGGCGAATTTACTGTTAGGTGGAACTCGAGTTCCACCTAACAGTAAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152544.1-1540s1c1
Sequence:CCGGCGCAGCATCTTCATATCATAACTCGAGTTATGATATGAAGATGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-263s1c1
Sequence:CCGGCCCTGATGTTGATTGGTTAATCTCGAGATTAACCAATCAACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152544.1-1541s1c1
Sequence:CCGGGCAGCATCTTCATATCATAAACTCGAGTTTATGATATGAAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152544
TRMT44 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 44 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-1055s1c1
Sequence:CCGGCCAGGTGTTCCAAGTTGTGAACTCGAGTTCACAACTTGGAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-429s1c1
Sequence:CCGGCGGGAATACCTTGACTTCATTCTCGAGAATGAAGTCAAGGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-783s1c1
Sequence:CCGGCCTGGATTTCATCCCAGAGAACTCGAGTTCTCTGGGATGAAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-428s1c1
Sequence:CCGGCCGGGAATACCTTGACTTCATCTCGAGATGAAGTCAAGGTATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-241s1c1
Sequence:CCGGCACCCAATGATAAGACCCTTTCTCGAGAAAGGGTCTTATCATTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152544.1-874s1c1
Sequence:CCGGCGAATTTACTGTTAGGTGGAACTCGAGTTCCACCTAACAGTAAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152544.1-1540s1c1
Sequence:CCGGCGCAGCATCTTCATATCATAACTCGAGTTATGATATGAAGATGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152544.1-263s1c1
Sequence:CCGGCCCTGATGTTGATTGGTTAATCTCGAGATTAACCAATCAACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152544.1-1541s1c1
Sequence:CCGGGCAGCATCTTCATATCATAAACTCGAGTTTATGATATGAAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030208
TRMT44 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 44 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030208.1-2459s1c1
Sequence:CCGGGAAGTCATTATCAGAGTCCTACTCGAGTAGGACTCTGATAATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1898s1c1
Sequence:CCGGCTTCTCAAGAATAGCCATCAACTCGAGTTGATGGCTATTCTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1354s1c1
Sequence:CCGGCCTCAGGATTCCTTCTACTAACTCGAGTTAGTAGAAGGAATCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1195s1c1
Sequence:CCGGGTCTTCCTACACCTGTCGTTTCTCGAGAAACGACAGGTGTAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030208.1-2446s1c1
Sequence:CCGGCACAGGGCTTTCTGAAGTCATCTCGAGATGACTTCAGAAAGCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030208.3-1287s21c1
Sequence:CCGGAGACACAGTACCGAGAGTATCCTCGAGGATACTCTCGGTACTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030208.3-1557s21c1
Sequence:CCGGACAGTTGCAGGACCGTCAATGCTCGAGCATTGACGGTCCTGCAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030208
TRMT44 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 44 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030208.1-2459s1c1
Sequence:CCGGGAAGTCATTATCAGAGTCCTACTCGAGTAGGACTCTGATAATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1898s1c1
Sequence:CCGGCTTCTCAAGAATAGCCATCAACTCGAGTTGATGGCTATTCTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1354s1c1
Sequence:CCGGCCTCAGGATTCCTTCTACTAACTCGAGTTAGTAGAAGGAATCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1195s1c1
Sequence:CCGGGTCTTCCTACACCTGTCGTTTCTCGAGAAACGACAGGTGTAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030208.1-2446s1c1
Sequence:CCGGCACAGGGCTTTCTGAAGTCATCTCGAGATGACTTCAGAAAGCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030208.3-1287s21c1
Sequence:CCGGAGACACAGTACCGAGAGTATCCTCGAGGATACTCTCGGTACTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030208.3-1557s21c1
Sequence:CCGGACAGTTGCAGGACCGTCAATGCTCGAGCATTGACGGTCCTGCAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030208
TRMT44 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 44 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030208.1-2459s1c1
Sequence:CCGGGAAGTCATTATCAGAGTCCTACTCGAGTAGGACTCTGATAATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1898s1c1
Sequence:CCGGCTTCTCAAGAATAGCCATCAACTCGAGTTGATGGCTATTCTTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1354s1c1
Sequence:CCGGCCTCAGGATTCCTTCTACTAACTCGAGTTAGTAGAAGGAATCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030208.1-1195s1c1
Sequence:CCGGGTCTTCCTACACCTGTCGTTTCTCGAGAAACGACAGGTGTAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030208.1-2446s1c1
Sequence:CCGGCACAGGGCTTTCTGAAGTCATCTCGAGATGACTTCAGAAAGCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030208.3-1287s21c1
Sequence:CCGGAGACACAGTACCGAGAGTATCCTCGAGGATACTCTCGGTACTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030208.3-1557s21c1
Sequence:CCGGACAGTTGCAGGACCGTCAATGCTCGAGCATTGACGGTCCTGCAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks