EMAIL THIS PAGE TO A FRIEND

TRMT5

tRNA methyltransferase 5

Synonyms: KIAA1393 TRM5
UniProtKB ID: Q32P41, B2RN19, Q9P2F4
Gene ID:
Human(57570) Summary: tRNAs contain as many as 13 or 14 nucleotides that are modified posttranscriptionally by enzymes that are highly specific for particular nucleotides in the tRNA structure. TRMT5 methylates the N1 position of guanosine-37 (G37) in selected tRNAs using S-adenosyl methionine (Brule et al., 2004 [PubMed 15248782]
Mouse(76357) TRM5 tRNA methyltransferase 5
Rat(362754) tRNA methyltransferase 5 homolog (S. cerevisiae)
Zebrafish(564078) TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae)
chicken(423520) tRNA methyltransferase 5 homolog (S. cerevisiae)
domestic cat(101081901) tRNA methyltransferase 5 homolog (S. cerevisiae)
Horse(100060773) tRNA methyltransferase 5 homolog (S. cerevisiae)
dog(480347) tRNA methyltransferase 5 homolog (S. cerevisiae)
cow(528221) TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae)
sheep(101105080) tRNA methyltransferase 5 homolog (S. cerevisiae)
domestic guinea pig(100735662) tRNA methyltransferase 5 homolog (S. cerevisiae)
naked mole-rat(101718155) tRNA methyltransferase 5 homolog (S. cerevisiae)
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000943 Anti-TRMT5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102581 Anti-TRMT5 antibody produced in rabbit affinity isolated antibody horse, bovine, human, rabbit
western blot pricing
SAB2106826 Anti-TRMT5 antibody produced in rabbit affinity isolated antibody rabbit, human, mouse, horse, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020810 Rosetta Predictions human pricing
NM_001108713 Rosetta Predictions rat pricing
NM_029580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048460 predicted 1072
2 SASI_Hs01_00048461 predicted 1078
3 SASI_Hs02_00353992 predicted 707
4 SASI_Hs01_00048463 predicted 1468
5 SASI_Hs01_00048464 predicted 366
6 SASI_Hs02_00353993 predicted 1051
7 SASI_Hs01_00048465 predicted 889
8 SASI_Hs01_00048467 predicted 686
9 SASI_Hs01_00048468 predicted 399
10 SASI_Hs01_00048469 predicted 1534
11 SASI_Hs01_00048462 predicted 741
12 SASI_Hs01_00048466 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241345 predicted 783
2 SASI_Rn02_00241346 predicted 754
3 SASI_Rn02_00241347 predicted 822
4 SASI_Rn02_00241348 predicted 676
5 SASI_Rn02_00241349 predicted 784
6 SASI_Rn02_00241350 predicted 400
7 SASI_Rn02_00241351 predicted 899
8 SASI_Rn02_00241352 predicted 811
9 SASI_Rn02_00241353 predicted 325
10 SASI_Rn02_00241354 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200310 predicted 693
2 SASI_Mm01_00200311 predicted 968
3 SASI_Mm01_00200312 predicted 589
4 SASI_Mm01_00200314 predicted 977
5 SASI_Mm02_00335528 predicted 366
6 SASI_Mm01_00200316 predicted 1435
7 SASI_Mm01_00200317 predicted 432
8 SASI_Mm01_00200319 predicted 988
9 SASI_Mm02_00335529 predicted 1422
10 SASI_Mm02_00335530 predicted 1003
11 SASI_Mm01_00200313 predicted 522
12 SASI_Mm01_00200315 predicted 1453
13 SASI_Mm01_00200318 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020810
VALIDATED
TRMT5 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-820s21c1
Sequence:CCGGTGACAATATGTACCGAAATTTCTCGAGAAATTTCGGTACATATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-412s21c1
Sequence:CCGGTAAATTGATGCGATCCCTAAACTCGAGTTTAGGGATCGCATCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020810.2-1919s21c1
Sequence:CCGGTACTAACTAGGAAGGTATTAACTCGAGTTAATACCTTCCTAGTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-503s21c1
Sequence:CCGGATCATGTTGGATCCCTATAAACTCGAGTTTATAGGGATCCAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020810.2-1428s21c1
Sequence:CCGGGCAGTTCAGTTCACCTGGTAACTCGAGTTACCAGGTGAACTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020810.1-3000s1c1
Sequence:CCGGGCGACATAAATAGTCACTTTACTCGAGTAAAGTGACTATTTATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020810.1-147s1c1
Sequence:CCGGCCATAGCATAACTGAATCAAACTCGAGTTTGATTCAGTTATGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020810.1-729s1c1
Sequence:CCGGGCTGCCTTTCAAACATTTAATCTCGAGATTAAATGTTTGAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020810.1-1421s1c1
Sequence:CCGGGCAGTTCAGTTCACCTGGTAACTCGAGTTACCAGGTGAACTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020810.1-373s1c1
Sequence:CCGGCCAGTGCTTAAAGTGAGGAAACTCGAGTTTCCTCACTTTAAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020810
VALIDATED
TRMT5 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-820s21c1
Sequence:CCGGTGACAATATGTACCGAAATTTCTCGAGAAATTTCGGTACATATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-412s21c1
Sequence:CCGGTAAATTGATGCGATCCCTAAACTCGAGTTTAGGGATCGCATCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020810.2-1919s21c1
Sequence:CCGGTACTAACTAGGAAGGTATTAACTCGAGTTAATACCTTCCTAGTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-503s21c1
Sequence:CCGGATCATGTTGGATCCCTATAAACTCGAGTTTATAGGGATCCAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020810.2-1428s21c1
Sequence:CCGGGCAGTTCAGTTCACCTGGTAACTCGAGTTACCAGGTGAACTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020810.1-3000s1c1
Sequence:CCGGGCGACATAAATAGTCACTTTACTCGAGTAAAGTGACTATTTATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020810.1-147s1c1
Sequence:CCGGCCATAGCATAACTGAATCAAACTCGAGTTTGATTCAGTTATGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020810.1-729s1c1
Sequence:CCGGGCTGCCTTTCAAACATTTAATCTCGAGATTAAATGTTTGAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020810.1-1421s1c1
Sequence:CCGGGCAGTTCAGTTCACCTGGTAACTCGAGTTACCAGGTGAACTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020810.1-373s1c1
Sequence:CCGGCCAGTGCTTAAAGTGAGGAAACTCGAGTTTCCTCACTTTAAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020810
VALIDATED
TRMT5 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-820s21c1
Sequence:CCGGTGACAATATGTACCGAAATTTCTCGAGAAATTTCGGTACATATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-412s21c1
Sequence:CCGGTAAATTGATGCGATCCCTAAACTCGAGTTTAGGGATCGCATCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020810.2-1919s21c1
Sequence:CCGGTACTAACTAGGAAGGTATTAACTCGAGTTAATACCTTCCTAGTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020810.2-503s21c1
Sequence:CCGGATCATGTTGGATCCCTATAAACTCGAGTTTATAGGGATCCAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020810.2-1428s21c1
Sequence:CCGGGCAGTTCAGTTCACCTGGTAACTCGAGTTACCAGGTGAACTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020810.1-3000s1c1
Sequence:CCGGGCGACATAAATAGTCACTTTACTCGAGTAAAGTGACTATTTATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020810.1-147s1c1
Sequence:CCGGCCATAGCATAACTGAATCAAACTCGAGTTTGATTCAGTTATGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020810.1-729s1c1
Sequence:CCGGGCTGCCTTTCAAACATTTAATCTCGAGATTAAATGTTTGAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020810.1-1421s1c1
Sequence:CCGGGCAGTTCAGTTCACCTGGTAACTCGAGTTACCAGGTGAACTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020810.1-373s1c1
Sequence:CCGGCCAGTGCTTAAAGTGAGGAAACTCGAGTTTCCTCACTTTAAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029580
VALIDATED
TRMT5 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-292s1c1
Sequence:CCGGCCTGTGCTTAAAGCGAGGAAACTCGAGTTTCCTCGCTTTAAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-376s1c1
Sequence:CCGGCGAGTGATTGAGGATCCCAAACTCGAGTTTGGGATCCTCAATCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-1602s1c1
Sequence:CCGGCCACACAGATATTTGTTACTACTCGAGTAGTAACAAATATCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-1089s1c1
Sequence:CCGGGCCAGTCAGAGAAGAGTTAATCTCGAGATTAACTCTTCTCTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029580
VALIDATED
TRMT5 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-292s1c1
Sequence:CCGGCCTGTGCTTAAAGCGAGGAAACTCGAGTTTCCTCGCTTTAAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-376s1c1
Sequence:CCGGCGAGTGATTGAGGATCCCAAACTCGAGTTTGGGATCCTCAATCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-1602s1c1
Sequence:CCGGCCACACAGATATTTGTTACTACTCGAGTAGTAACAAATATCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-1089s1c1
Sequence:CCGGGCCAGTCAGAGAAGAGTTAATCTCGAGATTAACTCTTCTCTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029580
VALIDATED
TRMT5 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-292s1c1
Sequence:CCGGCCTGTGCTTAAAGCGAGGAAACTCGAGTTTCCTCGCTTTAAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-376s1c1
Sequence:CCGGCGAGTGATTGAGGATCCCAAACTCGAGTTTGGGATCCTCAATCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-1602s1c1
Sequence:CCGGCCACACAGATATTTGTTACTACTCGAGTAGTAACAAATATCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029580.2-1089s1c1
Sequence:CCGGGCCAGTCAGAGAAGAGTTAATCTCGAGATTAACTCTTCTCTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks