EMAIL THIS PAGE TO A FRIEND

TRMT61A

tRNA methyltransferase 61 homolog A (S. cerevisiae)

Synonyms: C14orf172 GCD14 Gcd14p TRM61 hTRM61
UniProtKB ID: Q96FX7, A6NN78, Q8N7Q9
Gene ID:
Mouse(328162) tRNA methyltransferase 61A
Rat(314462) tRNA methyltransferase 61 homolog A (S. cerevisiae)
Zebrafish(436593) tRNA methyltransferase 61 homolog A (S. cerevisiae)
domestic cat(101098639) tRNA methyltransferase 61 homolog A (S. cerevisiae)
dog(490871) tRNA methyltransferase 61 homolog A (S. cerevisiae)
chicken(423481) tRNA methyltransferase 61 homolog A (S. cerevisiae)
cow(510283) tRNA methyltransferase 61 homolog A (S. cerevisiae)
sheep(101102182) tRNA methyltransferase 61 homolog A (S. cerevisiae)
domestic guinea pig(100722221) tRNA methyltransferase 61 homolog A (S. cerevisiae)
naked mole-rat(101712089) tRNA methyltransferase 61 homolog A (S. cerevisiae)
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103729 Anti-C14ORF172, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, rabbit, canine, human, mouse, rat, guinea pig, horse, zebrafish
western blot pricing
SAB2700607 Anti-TRMT61A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152307 Rosetta Predictions human pricing
NM_001007706 Rosetta Predictions rat pricing
NM_001099792 Rosetta Predictions mouse pricing
NM_001099793 Rosetta Predictions mouse pricing
NM_177374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365884 predicted 1044
2 SASI_Hs01_00165437 predicted 391
3 SASI_Hs02_00365885 predicted 1210
4 SASI_Hs01_00165440 predicted 235
5 SASI_Hs02_00365886 predicted 496
6 SASI_Hs02_00365887 predicted 601
7 SASI_Hs02_00365888 predicted 646
8 SASI_Hs02_00365889 predicted 641
9 SASI_Hs02_00365890 predicted 165
10 SASI_Hs02_00365891 predicted 139
11 SASI_Hs01_00165434 predicted 1415
12 SASI_Hs01_00165435 predicted 1278
13 SASI_Hs01_00165436 predicted 1221
14 SASI_Hs01_00165438 predicted 1402
15 SASI_Hs01_00165439 predicted 1412
16 SASI_Hs01_00165441 predicted 1410
17 SASI_Hs01_00165442 predicted 1402
18 SASI_Hs01_00165443 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093909 predicted 1410
2 SASI_Rn01_00093910 predicted 256
3 SASI_Rn01_00093911 predicted 670
4 SASI_Rn01_00093912 predicted 930
5 SASI_Rn01_00093913 predicted 592
6 SASI_Rn01_00093914 predicted 212
7 SASI_Rn01_00093915 predicted 1240
8 SASI_Rn01_00093916 predicted 475
9 SASI_Rn01_00093917 predicted 445
10 SASI_Rn01_00093918 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302045 predicted 490
2 SASI_Mm02_00302046 predicted 430
3 SASI_Mm02_00302047 predicted 643
4 SASI_Mm02_00302048 predicted 828
5 SASI_Mm02_00302049 predicted 564
6 SASI_Mm02_00302050 predicted 914
7 SASI_Mm02_00302051 predicted 640
8 SASI_Mm02_00302052 predicted 708
9 SASI_Mm02_00302053 predicted 695
10 SASI_Mm02_00302054 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302055 predicted 349
2 SASI_Mm02_00302056 predicted 291
3 SASI_Mm02_00302057 predicted 507
4 SASI_Mm02_00302058 predicted 692
5 SASI_Mm02_00302059 predicted 427
6 SASI_Mm02_00302060 predicted 779
7 SASI_Mm02_00302061 predicted 507
8 SASI_Mm02_00302062 predicted 568
9 SASI_Mm02_00302063 predicted 552
10 SASI_Mm02_00302064 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347533 predicted 1569
2 SASI_Mm02_00347534 predicted 740
3 SASI_Mm02_00347535 predicted 1281
4 SASI_Mm02_00347536 predicted 1274
5 SASI_Mm02_00347537 predicted 860
6 SASI_Mm02_00347538 predicted 1393
7 SASI_Mm02_00347539 predicted 1623
8 SASI_Mm01_00155098 predicted 1214
9 SASI_Mm02_00347540 predicted 1386
10 SASI_Mm02_00347541 predicted 1613
11 SASI_Mm01_00155093 predicted 758
12 SASI_Mm01_00155094 predicted 907
13 SASI_Mm01_00155095 predicted 517
14 SASI_Mm01_00155096 predicted 1156
15 SASI_Mm01_00155097 predicted 646
16 SASI_Mm01_00155099 predicted 915
17 SASI_Mm01_00155100 predicted 976
18 SASI_Mm01_00155101 predicted 644
19 SASI_Mm01_00155102 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177374
VALIDATED
TRMT61A MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 61 homolog A (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-798s21c1
Sequence:CCGGGACATTGCCTTGATCACCATGCTCGAGCATGGTGATCAAGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-686s21c1
Sequence:CCGGATTTGGCTCCAAGGTGATTTGCTCGAGCAAATCACCTTGGAGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-553s21c1
Sequence:CCGGTGATCAAGGAAGGCGACACAGCTCGAGCTGTGTCGCCTTCCTTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177374.2-1785s1c1
Sequence:CCGGGCTGTGGTTGAGCTAAATTAACTCGAGTTAATTTAGCTCAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177374.2-1245s1c1
Sequence:CCGGCCAACAACTTAGAGACCAACACTCGAGTGTTGGTCTCTAAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-1015s1c1
Sequence:CCGGTGACGCTGTCTTCTTGGATATCTCGAGATATCCAAGAAGACAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-832s1c1
Sequence:CCGGTGGTTCTGTATCCCACGCAATCTCGAGATTGCGTGGGATACAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-1155s1c1
Sequence:CCGGCCCATGACTTCACAGAGCTTACTCGAGTAAGCTCTGTGAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177374
VALIDATED
TRMT61A MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 61 homolog A (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-798s21c1
Sequence:CCGGGACATTGCCTTGATCACCATGCTCGAGCATGGTGATCAAGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-686s21c1
Sequence:CCGGATTTGGCTCCAAGGTGATTTGCTCGAGCAAATCACCTTGGAGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-553s21c1
Sequence:CCGGTGATCAAGGAAGGCGACACAGCTCGAGCTGTGTCGCCTTCCTTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177374.2-1785s1c1
Sequence:CCGGGCTGTGGTTGAGCTAAATTAACTCGAGTTAATTTAGCTCAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177374.2-1245s1c1
Sequence:CCGGCCAACAACTTAGAGACCAACACTCGAGTGTTGGTCTCTAAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-1015s1c1
Sequence:CCGGTGACGCTGTCTTCTTGGATATCTCGAGATATCCAAGAAGACAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-832s1c1
Sequence:CCGGTGGTTCTGTATCCCACGCAATCTCGAGATTGCGTGGGATACAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-1155s1c1
Sequence:CCGGCCCATGACTTCACAGAGCTTACTCGAGTAAGCTCTGTGAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177374
VALIDATED
TRMT61A MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 61 homolog A (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-798s21c1
Sequence:CCGGGACATTGCCTTGATCACCATGCTCGAGCATGGTGATCAAGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-686s21c1
Sequence:CCGGATTTGGCTCCAAGGTGATTTGCTCGAGCAAATCACCTTGGAGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177374.4-553s21c1
Sequence:CCGGTGATCAAGGAAGGCGACACAGCTCGAGCTGTGTCGCCTTCCTTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177374.2-1785s1c1
Sequence:CCGGGCTGTGGTTGAGCTAAATTAACTCGAGTTAATTTAGCTCAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177374.2-1245s1c1
Sequence:CCGGCCAACAACTTAGAGACCAACACTCGAGTGTTGGTCTCTAAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-1015s1c1
Sequence:CCGGTGACGCTGTCTTCTTGGATATCTCGAGATATCCAAGAAGACAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-832s1c1
Sequence:CCGGTGGTTCTGTATCCCACGCAATCTCGAGATTGCGTGGGATACAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177374.2-1155s1c1
Sequence:CCGGCCCATGACTTCACAGAGCTTACTCGAGTAAGCTCTGTGAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152307
VALIDATED
TRMT61A MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 61 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-652s21c1
Sequence:CCGGTCTTCCTGGACATCCCATCACCTCGAGGTGATGGGATGTCCAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152307.2-371s21c1
Sequence:CCGGGCAGATCCTCTACTCCACAGACTCGAGTCTGTGGAGTAGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-395s21c1
Sequence:CCGGCGCCCTCATCACCATGATGTTCTCGAGAACATCATGGTGATGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152307.2-2883s21c1
Sequence:CCGGGGCGCAGCTCCATGGTTTATACTCGAGTATAAACCATGGAGCTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-248s21c1
Sequence:CCGGGCGGCACTCAGTTGACCTTATCTCGAGATAAGGTCAACTGAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152307.1-374s1c1
Sequence:CCGGGATCCTCTACTCCACAGACATCTCGAGATGTCTGTGGAGTAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152307
VALIDATED
TRMT61A MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 61 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-652s21c1
Sequence:CCGGTCTTCCTGGACATCCCATCACCTCGAGGTGATGGGATGTCCAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152307.2-371s21c1
Sequence:CCGGGCAGATCCTCTACTCCACAGACTCGAGTCTGTGGAGTAGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-395s21c1
Sequence:CCGGCGCCCTCATCACCATGATGTTCTCGAGAACATCATGGTGATGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152307.2-2883s21c1
Sequence:CCGGGGCGCAGCTCCATGGTTTATACTCGAGTATAAACCATGGAGCTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-248s21c1
Sequence:CCGGGCGGCACTCAGTTGACCTTATCTCGAGATAAGGTCAACTGAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152307.1-374s1c1
Sequence:CCGGGATCCTCTACTCCACAGACATCTCGAGATGTCTGTGGAGTAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152307
VALIDATED
TRMT61A MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 61 homolog A (S. cerevisiae)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-652s21c1
Sequence:CCGGTCTTCCTGGACATCCCATCACCTCGAGGTGATGGGATGTCCAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152307.2-371s21c1
Sequence:CCGGGCAGATCCTCTACTCCACAGACTCGAGTCTGTGGAGTAGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-395s21c1
Sequence:CCGGCGCCCTCATCACCATGATGTTCTCGAGAACATCATGGTGATGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152307.2-2883s21c1
Sequence:CCGGGGCGCAGCTCCATGGTTTATACTCGAGTATAAACCATGGAGCTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152307.2-248s21c1
Sequence:CCGGGCGGCACTCAGTTGACCTTATCTCGAGATAAGGTCAACTGAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152307.1-374s1c1
Sequence:CCGGGATCCTCTACTCCACAGACATCTCGAGATGTCTGTGGAGTAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks